Morpholino

MO2-bag3

ID
ZDB-MRPHLNO-110321-7
Name
MO2-bag3
Previous Names
None
Target
Sequence
5' - GCTTTCTCATGATCTTACCTCAGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO, targets splice donor sites of exon 2.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-bag3
No data available
Phenotype
Phenotype resulting from MO2-bag3
Phenotype of all Fish created by or utilizing MO2-bag3
Phenotype Fish Conditions Figures
heart contraction disrupted, abnormal AB/TU + MO2-bag3 standard conditions Fig. 3 from Norton et al., 2011
pericardium edematous, abnormal AB/TU + MO2-bag3 standard conditions Fig. 3 from Norton et al., 2011
trunk curved, abnormal AB/TU + MO2-bag3 standard conditions Fig. 3 from Norton et al., 2011
heart contraction decreased magnitude, abnormal WT + MO2-bag3 standard conditions Fig 3 with imageFig 4 with image from Diofano et al., 2020
skeletal muscle refractivity, abnormal WT + MO2-bag3 standard conditions Fig. S4 with image from Bührdel et al., 2015
whole organism decreased mobility, abnormal WT + MO2-bag3 standard conditions Fig. 2 with image from Bührdel et al., 2015
heart contraction decreased frequency, abnormal WT + MO2-bag3 standard conditions Fig 3 with imageFig 4 with image from Diofano et al., 2020
pericardium edematous, abnormal WT + MO2-bag3 standard conditions Fig. S4 with image from Bührdel et al., 2015
locomotion disrupted, abnormal WT + MO2-bag3 standard conditions Fig. 2 with image from Bührdel et al., 2015
cardiac muscle structure, abnormal WT + MO2-bag3 standard conditions Fig 3 with image from Diofano et al., 2020
thigmotaxis disrupted, abnormal WT + MO2-bag3 standard conditions Fig. 2 with image from Bührdel et al., 2015
response to mechanical stimulus decreased magnitude, abnormal WT + MO2-bag3 standard conditions Fig 3 with imageFig 4 with image from Diofano et al., 2020
skeletal muscle structure, abnormal WT + MO2-bag3 standard conditions Fig 3 with imageFig 4 with image from Diofano et al., 2020
trunk curved, abnormal WT + MO2-bag3 standard conditions Fig. S4 with image from Bührdel et al., 2015
skeletal muscle malformed, abnormal WT + MO2-bag3 standard conditions Fig 4 with image from Diofano et al., 2020
skeletal muscle structure, abnormal bag3ulm104/+ + MO2-bag3 standard conditions Fig 4 with image from Diofano et al., 2020
heart contraction decreased magnitude, abnormal bag3ulm104/+ + MO2-bag3 standard conditions Fig 4 with image from Diofano et al., 2020
response to mechanical stimulus decreased magnitude, abnormal bag3ulm104/+ + MO2-bag3 standard conditions Fig 4 with image from Diofano et al., 2020
skeletal muscle malformed, abnormal bag3ulm104/+ + MO2-bag3 standard conditions Fig 4 with image from Diofano et al., 2020
heart contraction decreased frequency, abnormal bag3ulm104/+ + MO2-bag3 standard conditions Fig 4 with image from Diofano et al., 2020
Citations