Morpholino

MO1-tnnt2c

ID

ZDB-MRPHLNO-110228-1

Name

MO1-tnnt2c

Previous Names

None

Target

tnnt2c (1)

Sequence

5' - CCACAAACTCTTCGGTGTCGCACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tnnt2c

No data available

Phenotype

Phenotype resulting from MO1-tnnt2c

Phenotype	Fish	Figures
muscle cell myofibril absent, abnormal	WT + MO1-tnnt2c	Fig. S9 from Ferrante et al., 2011
sarcomere organization disrupted, abnormal	WT + MO1-tnnt2c	Fig. 7 from Ferrante et al., 2011
slow muscle cell filamentous actin dispersed, abnormal	WT + MO1-tnnt2c	Fig. 7 from Ferrante et al., 2011
slow muscle cell myofibril decreased thickness, abnormal	WT + MO1-tnnt2c	Fig. 7, Fig. 8 from Ferrante et al., 2011
slow muscle cell myofibril undulate, abnormal	WT + MO1-tnnt2c	Fig. 7 from Ferrante et al., 2011
slow muscle cell sarcomere absent, abnormal	WT + MO1-tnnt2c	Fig. 7 from Ferrante et al., 2011
striated muscle cell development disrupted, abnormal	WT + MO1-tnnt2c	Fig. S9 from Ferrante et al., 2011
whole organism immobile, abnormal	WT + MO1-tnnt2c	text only from Ferrante et al., 2011

Phenotype of all Fish created by or utilizing MO1-tnnt2c

Phenotype	Fish	Conditions	Figures
slow muscle cell sarcomere absent, abnormal	WT + MO1-tnnt2c	standard conditions	Fig. 7 from Ferrante et al., 2011
striated muscle cell development disrupted, abnormal	WT + MO1-tnnt2c	standard conditions	Fig. S9 from Ferrante et al., 2011
whole organism immobile, abnormal	WT + MO1-tnnt2c	standard conditions	text only from Ferrante et al., 2011
muscle cell myofibril absent, abnormal	WT + MO1-tnnt2c	standard conditions	Fig. S9 from Ferrante et al., 2011
slow muscle cell filamentous actin dispersed, abnormal	WT + MO1-tnnt2c	standard conditions	Fig. 7 from Ferrante et al., 2011
slow muscle cell myofibril undulate, abnormal	WT + MO1-tnnt2c	standard conditions	Fig. 7 from Ferrante et al., 2011
sarcomere organization disrupted, abnormal	WT + MO1-tnnt2c	standard conditions	Fig. 7 from Ferrante et al., 2011
slow muscle cell myofibril decreased thickness, abnormal	WT + MO1-tnnt2c	standard conditions	Fig. 7, Fig. 8 from Ferrante et al., 2011
slow muscle cell sarcomere absent, abnormal	WT + MO1-tnnt2c + MO1-tnnt2d	standard conditions	Fig. 8 from Ferrante et al., 2011
myofibril assembly disrupted, abnormal	WT + MO1-tnnt2c + MO1-tnnt2d	standard conditions	Fig. 8 from Ferrante et al., 2011
fast muscle cell muscle thin filament tropomyosin absent, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1 from Ferrante et al., 2011
somite shape, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	text only from Ferrante et al., 2011
actin filament bundle distribution disrupted, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 2 from Ferrante et al., 2011
fast muscle cell filamentous actin decreased amount, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1 from Ferrante et al., 2011
striated muscle cell development disrupted, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1 from Ferrante et al., 2011
skeletal muscle Z disc disorganized, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1, Fig. 2 from Ferrante et al., 2011
skeletal muscle sarcomere disorganized, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 3 from Ferrante et al., 2011
skeletal muscle M band dispersed, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 2 from Ferrante et al., 2011
whole organism immobile, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	text only from Ferrante et al., 2011
fast muscle cell myosin filament dispersed, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 2 from Ferrante et al., 2011
sarcomere organization disrupted, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1 from Ferrante et al., 2011
fast muscle cell myofibril disorganized, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1 from Ferrante et al., 2011
pericardium edematous, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	text only from Ferrante et al., 2011
whole organism bent, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	text only from Ferrante et al., 2011

Citations