Morpholino

MO1-tnnt2c

ID
ZDB-MRPHLNO-110228-1
Name
MO1-tnnt2c
Previous Names
None
Target
Sequence
5' - CCACAAACTCTTCGGTGTCGCACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tnnt2c
No data available
Phenotype
Phenotype resulting from MO1-tnnt2c
Phenotype of all Fish created by or utilizing MO1-tnnt2c
Phenotype Fish Conditions Figures
slow muscle cell sarcomere absent, abnormal WT + MO1-tnnt2c standard conditions Fig. 7 from Ferrante et al., 2011
striated muscle cell development disrupted, abnormal WT + MO1-tnnt2c standard conditions Fig. S9 from Ferrante et al., 2011
whole organism immobile, abnormal WT + MO1-tnnt2c standard conditions text only from Ferrante et al., 2011
muscle cell myofibril absent, abnormal WT + MO1-tnnt2c standard conditions Fig. S9 from Ferrante et al., 2011
slow muscle cell filamentous actin dispersed, abnormal WT + MO1-tnnt2c standard conditions Fig. 7 from Ferrante et al., 2011
slow muscle cell myofibril undulate, abnormal WT + MO1-tnnt2c standard conditions Fig. 7 from Ferrante et al., 2011
sarcomere organization disrupted, abnormal WT + MO1-tnnt2c standard conditions Fig. 7 from Ferrante et al., 2011
slow muscle cell myofibril decreased thickness, abnormal WT + MO1-tnnt2c standard conditions Fig. 7Fig. 8 from Ferrante et al., 2011
slow muscle cell sarcomere absent, abnormal WT + MO1-tnnt2c + MO1-tnnt2d standard conditions Fig. 8 from Ferrante et al., 2011
myofibril assembly disrupted, abnormal WT + MO1-tnnt2c + MO1-tnnt2d standard conditions Fig. 8 from Ferrante et al., 2011
fast muscle cell muscle thin filament tropomyosin absent, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1 from Ferrante et al., 2011
somite shape, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions text only from Ferrante et al., 2011
fast muscle cell filamentous actin decreased amount, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1 from Ferrante et al., 2011
actin filament bundle distribution disrupted, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 2 from Ferrante et al., 2011
striated muscle cell development disrupted, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1 from Ferrante et al., 2011
skeletal muscle Z disc disorganized, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1Fig. 2 from Ferrante et al., 2011
skeletal muscle sarcomere disorganized, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 3 from Ferrante et al., 2011
skeletal muscle M band dispersed, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 2 from Ferrante et al., 2011
whole organism immobile, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions text only from Ferrante et al., 2011
fast muscle cell myosin filament dispersed, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 2 from Ferrante et al., 2011
sarcomere organization disrupted, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1 from Ferrante et al., 2011
fast muscle cell myofibril disorganized, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions Fig. 1 from Ferrante et al., 2011
pericardium edematous, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions text only from Ferrante et al., 2011
whole organism bent, abnormal WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b standard conditions text only from Ferrante et al., 2011
Citations