Morpholino

MO1-cobl

ID
ZDB-MRPHLNO-110218-2
Name
MO1-cobl
Previous Names
  • cobl-MOa (1)
Target
Sequence
5' - CCTGGGCCTTCATTCTCCTCCTGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO that straddles the intron 1 - exon 2 boundary (splice acceptor site), resulting in either the splicing out of coding exon 2, use of a cryptic splice site in exon 2, or the retention of intron 1. ( ZDB-PUB-101209-18 )
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cobl
No data available
Phenotype
Phenotype resulting from MO1-cobl
Phenotype Fish Figures
ciliated epithelial cell apical cortex composition, abnormal EKW + MO1-cobl Fig. 6 with image from Ravanelli et al., 2011
ciliated epithelial cell filamentous actin decreased mass, abnormal EKW + MO1-cobl Fig. 6 with image from Ravanelli et al., 2011
cilium assembly process quality, abnormal EKW + MO1-cobl Fig. 5 with image from Ravanelli et al., 2011
determination of left/right asymmetry in lateral mesoderm process quality, abnormal EKW + MO1-cobl Fig. 4 with image from Ravanelli et al., 2011
head decreased size, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
heart jogging process quality, abnormal f1Tg + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
heart tube bilateral symmetry, abnormal f1Tg + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
Kupffer's vesicle ciliated epithelial cell physical object quality, abnormal EKW + MO1-cobl Fig. 6 with image from Ravanelli et al., 2011
Kupffer's vesicle motile cilium decreased length, abnormal EKW + MO1-cobl Fig. 5 with image from Ravanelli et al., 2011
post-vent region curled, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
pronephric duct motile cilium decreased length, abnormal EKW + MO1-cobl Fig. 5 with image from Ravanelli et al., 2011
pronephric duct motile cilium direction, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
pronephric glomerulus cystic, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
pronephric proximal convoluted tubule increased diameter, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
pronephric tubule increased diameter, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
trunk curved ventral, abnormal EKW + MO1-cobl Fig. 3 with image from Ravanelli et al., 2011
Phenotype of all Fish created by or utilizing MO1-cobl
Phenotype Fish Conditions Figures
post-vent region curled, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
pronephric glomerulus cystic, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
pronephric proximal convoluted tubule increased diameter, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
pronephric tubule increased diameter, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
head decreased size, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
cilium assembly process quality, abnormal EKW + MO1-cobl standard conditions Fig. 5 with image from Ravanelli et al., 2011
determination of left/right asymmetry in lateral mesoderm process quality, abnormal EKW + MO1-cobl standard conditions Fig. 4 with image from Ravanelli et al., 2011
trunk curved ventral, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
ciliated epithelial cell filamentous actin decreased mass, abnormal EKW + MO1-cobl standard conditions Fig. 6 with image from Ravanelli et al., 2011
Kupffer's vesicle ciliated epithelial cell physical object quality, abnormal EKW + MO1-cobl standard conditions Fig. 6 with image from Ravanelli et al., 2011
pronephric duct motile cilium direction, abnormal EKW + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
ciliated epithelial cell apical cortex composition, abnormal EKW + MO1-cobl standard conditions Fig. 6 with image from Ravanelli et al., 2011
pronephric duct motile cilium decreased length, abnormal EKW + MO1-cobl standard conditions Fig. 5 with image from Ravanelli et al., 2011
Kupffer's vesicle motile cilium decreased length, abnormal EKW + MO1-cobl standard conditions Fig. 5 with image from Ravanelli et al., 2011
Kupffer's vesicle motile cilium decreased length, abnormal EKW + MO1-cobl + MO2-cobl standard conditions Fig. 5 with image from Ravanelli et al., 2011
cilium assembly process quality, abnormal EKW + MO1-cobl + MO2-cobl standard conditions Fig. 5 with image from Ravanelli et al., 2011
heart jogging process quality, abnormal f1Tg + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
heart tube bilateral symmetry, abnormal f1Tg + MO1-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
heart tube bilateral symmetry, abnormal f1Tg + MO1-cobl + MO2-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
heart jogging process quality, abnormal f1Tg + MO1-cobl + MO2-cobl standard conditions Fig. 3 with image from Ravanelli et al., 2011
Citations