Morpholino

MO2-setdb2

ID
ZDB-MRPHLNO-110201-2
Name
MO2-setdb2
Previous Names
  • MO2 (1)
Target
Sequence
5' - TTGCTGTGTCGGCTTCAGTCTCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-setdb2
No data available
Phenotype
Phenotype resulting from MO2-setdb2
Phenotype Fish Figures
axis decreased length, abnormal WT + MO2-setdb2 Fig. S5 with image from Xu et al., 2010
axis increased width, abnormal WT + MO2-setdb2 Fig. S5 with image from Xu et al., 2010
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal WT + MO2-setdb2 Fig. 2 with imageFig. 3 with image from Xu et al., 2010
determination of left/right asymmetry in diencephalon disrupted, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-setdb2 Fig. 3 with image from Xu et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO2-setdb2 Fig. 4 with image from Xu et al., 2010
determination of liver left/right asymmetry disrupted, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
diencephalon structure, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
gut centered, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
gut mislocalised radially, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
heart tube centered, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
heart tube mislocalised radially, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO2-setdb2 Fig. 3 with image from Xu et al., 2010
lateral plate mesoderm structure, abnormal WT + MO2-setdb2 Fig. 3 with image from Xu et al., 2010
liver centered, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
liver mislocalised radially, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
notochord undulate, abnormal WT + MO2-setdb2 Fig. S5 with image from Xu et al., 2010
pancreas centered, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
pancreas mislocalised radially, abnormal WT + MO2-setdb2 Fig. 2 with image from Xu et al., 2010
primitive heart tube centered, abnormal WT + MO2-setdb2 Fig. 3 with image from Xu et al., 2010
primitive heart tube mislocalised radially, abnormal WT + MO2-setdb2 Fig. 3 with image from Xu et al., 2010
shield distended, abnormal WT + MO2-setdb2 Fig. 4 with image from Xu et al., 2010
Phenotype of all Fish created by or utilizing MO2-setdb2
Phenotype Fish Conditions Figures
gut centered, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
heart tube mislocalised radially, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
primitive heart tube mislocalised radially, abnormal WT + MO2-setdb2 standard conditions Fig. 3 with image from Xu et al., 2010
diencephalon structure, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
pancreas centered, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
primitive heart tube centered, abnormal WT + MO2-setdb2 standard conditions Fig. 3 with image from Xu et al., 2010
determination of left/right asymmetry in diencephalon disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
axis increased width, abnormal WT + MO2-setdb2 standard conditions Fig. S5 with image from Xu et al., 2010
pancreas mislocalised radially, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
liver mislocalised radially, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
lateral plate mesoderm structure, abnormal WT + MO2-setdb2 standard conditions Fig. 3 with image from Xu et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 3 with image from Xu et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 4 with image from Xu et al., 2010
determination of liver left/right asymmetry disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO2-setdb2 standard conditions Fig. 3 with image from Xu et al., 2010
notochord undulate, abnormal WT + MO2-setdb2 standard conditions Fig. S5 with image from Xu et al., 2010
gut mislocalised radially, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
shield distended, abnormal WT + MO2-setdb2 standard conditions Fig. 4 with image from Xu et al., 2010
determination of digestive tract left/right asymmetry disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
heart tube centered, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with imageFig. 3 with image from Xu et al., 2010
axis decreased length, abnormal WT + MO2-setdb2 standard conditions Fig. S5 with image from Xu et al., 2010
liver centered, abnormal WT + MO2-setdb2 standard conditions Fig. 2 with image from Xu et al., 2010
Citations