Morpholino

MO1-f11r.1

ID

ZDB-MRPHLNO-110121-1

Name

MO1-f11r.1

Previous Names

Target

Sequence

5' - AGCACACAAAGGCGAAGGTCAACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-f11r.1

Expressed Gene	Anatomy	Figures
cdh17	pronephros	Fig. S4 from Kobayashi et al., 2014
desma	somite	Fig. 2, Fig. S4 from Kobayashi et al., 2014
dlc	somite	Fig. 4 from Kobayashi et al., 2014
dld	somite	Fig. 4 from Kobayashi et al., 2014
efnb2a	dorsal aorta	Fig. 1 from Kobayashi et al., 2014
fli1	posterior lateral mesoderm	Fig. 2 from Kobayashi et al., 2014
flt4	vein	Fig. S4 from Kobayashi et al., 2014
gata1a	erythroid lineage cell	Fig. S4 from Kobayashi et al., 2014
kdrl	blood island endothelial cell trunk endothelial cell	Fig. S4 from Kobayashi et al., 2014
lcp1	myeloid cell	Fig. S4 from Kobayashi et al., 2014
myb	dorsal aorta	Fig. 1 from Kobayashi et al., 2014
nkx3-1	sclerotome	Fig. S4 from Kobayashi et al., 2014
rag1	(not) thymus T cell	Fig. 1 from Kobayashi et al., 2014
runx1	(not) dorsal aorta head	Fig. 1, Fig. 4, Fig. S7 from Kobayashi et al., 2014
shha	notochord	Fig. S4 from Kobayashi et al., 2014
tal1	dorsal aorta	Fig. 1 from Kobayashi et al., 2014
tbx20	dorsal aorta	Fig. S4 from Kobayashi et al., 2014
vegfaa	unspecified	Fig. S4 from Kobayashi et al., 2014

Phenotype

Phenotype resulting from MO1-f11r.1

Phenotype	Fish	Figures
endothelial cell Notch signaling pathway decreased process quality, abnormal	um13Tg; um14Tg + MO1-f11r.1	Fig. 4 from Kobayashi et al., 2014
posterior lateral line neuromast spatial pattern, abnormal	zf106Tg + MO1-f11r.1	Fig. S4 from Gallardo et al., 2010
posterior lateral line neuromast deposition process quality, abnormal	zf106Tg + MO1-f11r.1	Fig. S4 from Gallardo et al., 2010
posterior lateral line primordium organization quality, abnormal	zf106Tg + MO1-f11r.1	Fig. 4 from Gallardo et al., 2010
posterior lateral line primordium shape, abnormal	zf106Tg + MO1-f11r.1	Fig. 4 from Gallardo et al., 2010
posterior lateral mesoderm cell shape, abnormal	hzm7Et; y1Tg + MO1-f11r.1	Fig. 2 from Kobayashi et al., 2014
ventral wall of dorsal aorta apoptotic process increased process quality, abnormal	um13Tg; um14Tg + MO1-f11r.1	Fig. 4 from Kobayashi et al., 2014
ventral wall of dorsal aorta Notch signaling pathway decreased process quality, abnormal	um13Tg; um14Tg + MO1-f11r.1	Fig. 4 from Kobayashi et al., 2014

Phenotype of all Fish created by or utilizing MO1-f11r.1

Phenotype	Fish	Conditions	Figures
posterior lateral line primordium shape, abnormal	zf106Tg + MO1-f11r.1	standard conditions	Fig. 4 from Gallardo et al., 2010
posterior lateral line neuromast deposition process quality, abnormal	zf106Tg + MO1-f11r.1	standard conditions	Fig. S4 from Gallardo et al., 2010
posterior lateral line neuromast spatial pattern, abnormal	zf106Tg + MO1-f11r.1	standard conditions	Fig. S4 from Gallardo et al., 2010
posterior lateral line primordium organization quality, abnormal	zf106Tg + MO1-f11r.1	standard conditions	Fig. 4 from Gallardo et al., 2010
posterior lateral mesoderm cell shape, abnormal	hzm7Et; y1Tg + MO1-f11r.1	standard conditions	Fig. 2 from Kobayashi et al., 2014
ventral wall of dorsal aorta Notch signaling pathway decreased process quality, abnormal	um13Tg; um14Tg + MO1-f11r.1	standard conditions	Fig. 4 from Kobayashi et al., 2014
endothelial cell Notch signaling pathway decreased process quality, abnormal	um13Tg; um14Tg + MO1-f11r.1	standard conditions	Fig. 4 from Kobayashi et al., 2014
ventral wall of dorsal aorta apoptotic process increased process quality, abnormal	um13Tg; um14Tg + MO1-f11r.1	standard conditions	Fig. 4 from Kobayashi et al., 2014

Citations