Morpholino

MO2-dachb

ID

ZDB-MRPHLNO-101217-1

Name

MO2-dachb

Previous Names

dachb-MO-S (1)

Target

dachb (1)

Sequence

5' - CTCAATGAGGGTTTACCTGTGGGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.Targets the exon2–intron2 splice boundary.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-dachb

Expressed Gene	Anatomy	Figures
gcga	posterior pancreatic bud	Fig. 2 from Kalousova et al., 2010
ins	posterior pancreatic bud	Fig. 2 from Kalousova et al., 2010
sst2	posterior pancreatic bud	Fig. 2 from Kalousova et al., 2010

Phenotype

Phenotype resulting from MO2-dachb

Phenotype	Fish	Figures
endocrine pancreas development disrupted, abnormal	WT + MO2-dachb	Fig. 4 from Yang et al., 2021 Fig. 2 from Kalousova et al., 2010
islet ab2-isl labeling decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 4 from Yang et al., 2021
islet shape, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 4 from Yang et al., 2021
islet cell decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 4 , Fig. 5 from Yang et al., 2021
islet cell decreased volume, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 4 , Fig. 5 from Yang et al., 2021
pancreatic B cell ins expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 4 from Yang et al., 2021
pancreatic B cell decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 4 , Fig. 5 from Yang et al., 2021
posterior pancreatic bud endocrine cell decreased amount, abnormal	WT + MO2-dachb	Fig. 2 from Kalousova et al., 2010
type B pancreatic cell development disrupted, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 4 from Yang et al., 2021
whole organism sst2 expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 8 from Yang et al., 2021
whole organism ins expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 8 from Yang et al., 2021
whole organism insm1a expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 8 from Yang et al., 2021
whole organism ptf1a expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 8 from Yang et al., 2021
whole organism nkx6.1 expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 8 from Yang et al., 2021
whole organism dacha expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 7 from Yang et al., 2021
whole organism dachb expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 3 , Fig. 7 from Yang et al., 2021
whole organism pax6a expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 8 from Yang et al., 2021
whole organism neurod1 expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	Fig. 8 from Yang et al., 2021

Phenotype of all Fish created by or utilizing MO2-dachb

Phenotype	Fish	Conditions	Figures
whole organism ptf1a expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 8 from Yang et al., 2021
whole organism pax6a expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 8 from Yang et al., 2021
islet ab2-isl labeling decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 4 from Yang et al., 2021
islet cell decreased volume, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 4 , Fig. 5 from Yang et al., 2021
whole organism sst2 expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 8 from Yang et al., 2021
islet cell decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 4 , Fig. 5 from Yang et al., 2021
type B pancreatic cell development disrupted, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 4 from Yang et al., 2021
pancreatic B cell decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 4 , Fig. 5 from Yang et al., 2021
endocrine pancreas development disrupted, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 4 from Yang et al., 2021
whole organism dachb expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 3 , Fig. 7 from Yang et al., 2021
whole organism ins expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 8 from Yang et al., 2021
whole organism dacha expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 7 from Yang et al., 2021
whole organism nkx6.1 expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 8 from Yang et al., 2021
pancreatic B cell ins expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 4 from Yang et al., 2021
whole organism insm1a expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 8 from Yang et al., 2021
whole organism neurod1 expression decreased amount, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 8 from Yang et al., 2021
islet shape, abnormal	AB + MO2-dachb + MO4-tp53	standard conditions	Fig. 4 from Yang et al., 2021
posterior pancreatic bud endocrine cell decreased amount, abnormal	WT + MO2-dachb	standard conditions	Fig. 2 from Kalousova et al., 2010
endocrine pancreas development disrupted, abnormal	WT + MO2-dachb	standard conditions	Fig. 2 from Kalousova et al., 2010

Citations