Morpholino

MO1-atl1

ID

ZDB-MRPHLNO-101105-4

Name

MO1-atl1

Previous Names

None

Target

atl1 (1)

Sequence

5' - CTGTCCTTTTTGTCCCGTGCCATGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-atl1

No data available

Phenotype

Phenotype resulting from MO1-atl1

Phenotype	Fish	Figures
secondary motor neuron axon guidance process quality, abnormal	WT + MO1-atl1	Fig. 6 from Jardin et al., 2018

Phenotype of all Fish created by or utilizing MO1-atl1

Phenotype	Fish	Conditions	Figures
secondary motor neuron axon guidance process quality, abnormal	WT + MO1-atl1	control	Fig. 6 from Jardin et al., 2018
peripheral neuron decreased thickness, abnormal	WT + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 3 from Fassier et al., 2010
motor neuron axon guidance disrupted, abnormal	WT + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 3 from Fassier et al., 2010
cerebellum disorganized, abnormal	WT + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 3 from Fassier et al., 2010
multicellular organismal locomotion decreased rate, abnormal	WT + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 2 from Fassier et al., 2010
secondary motor neuron axon mislocalised, abnormal	WT + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 3 from Fassier et al., 2010
primary motor neuron axon branched, abnormal	WT + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 3 from Fassier et al., 2010
thigmotaxis decreased rate, abnormal	WT + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 2 from Fassier et al., 2010
peripheral neuron decreased length, abnormal	WT + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 3 from Fassier et al., 2010
thigmotaxis decreased rate, abnormal	ml3Tg + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 4 from Fassier et al., 2010
secondary motor neuron axon guidance process quality, exacerbated	ml2Tg + MO1-atl1 + MO3-spast	control	Fig. 6 from Jardin et al., 2018
secondary motor neuron axon guidance process quality, exacerbated	ml2Tg + MO1-atl1 + MO4-spast	control	Fig. 6 from Jardin et al., 2018
secondary motor neuron axon guidance process quality, abnormal	w30Tg + MO1-atl1	control	Fig. 6 from Jardin et al., 2018
secondary motor neuron axon guidance process quality, ameliorated	w30Tg + MO1-atl1	heat shock	Fig. 6 from Jardin et al., 2018
thigmotaxis decreased rate, abnormal	w30Tg + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 8 from Fassier et al., 2010
multicellular organismal locomotion decreased rate, abnormal	w30Tg + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 8 from Fassier et al., 2010
peripheral neuron decreased length, abnormal	w30Tg + MO1-atl1 + MO2-atl1 + MO3-atl1	standard conditions	Fig. 8 from Fassier et al., 2010

Citations