Morpholino

MO1-atl1

ID
ZDB-MRPHLNO-101105-4
Name
MO1-atl1
Previous Names
None
Target
Sequence
5' - CTGTCCTTTTTGTCCCGTGCCATGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atl1
No data available
Phenotype
Phenotype resulting from MO1-atl1
Phenotype of all Fish created by or utilizing MO1-atl1
Phenotype Fish Conditions Figures
secondary motor neuron axon guidance process quality, abnormal WT + MO1-atl1 control Fig. 6 with image from Jardin et al., 2018
peripheral neuron decreased thickness, abnormal WT + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 3 from Fassier et al., 2010
motor neuron axon guidance disrupted, abnormal WT + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 3 from Fassier et al., 2010
cerebellum disorganized, abnormal WT + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 3 from Fassier et al., 2010
multicellular organismal locomotion decreased rate, abnormal WT + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 2 from Fassier et al., 2010
secondary motor neuron axon mislocalised, abnormal WT + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 3 from Fassier et al., 2010
primary motor neuron axon branched, abnormal WT + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 3 from Fassier et al., 2010
thigmotaxis decreased rate, abnormal WT + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 2 from Fassier et al., 2010
peripheral neuron decreased length, abnormal WT + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 3 from Fassier et al., 2010
thigmotaxis decreased rate, abnormal ml3Tg + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 4 from Fassier et al., 2010
secondary motor neuron axon guidance process quality, exacerbated ml2Tg + MO1-atl1 + MO3-spast control Fig. 6 with image from Jardin et al., 2018
secondary motor neuron axon guidance process quality, exacerbated ml2Tg + MO1-atl1 + MO4-spast control Fig. 6 with image from Jardin et al., 2018
secondary motor neuron axon guidance process quality, abnormal w30Tg + MO1-atl1 control Fig. 6 with image from Jardin et al., 2018
secondary motor neuron axon guidance process quality, ameliorated w30Tg + MO1-atl1 heat shock Fig. 6 with image from Jardin et al., 2018
thigmotaxis decreased rate, abnormal w30Tg + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 8 from Fassier et al., 2010
multicellular organismal locomotion decreased rate, abnormal w30Tg + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 8 from Fassier et al., 2010
peripheral neuron decreased length, abnormal w30Tg + MO1-atl1 + MO2-atl1 + MO3-atl1 standard conditions Fig. 8 from Fassier et al., 2010
Citations