Morpholino

MO2-itgb1b

ID

ZDB-MRPHLNO-101103-1

Name

MO2-itgb1b

Previous Names

Target

Sequence

5' - GGAGCAGCCTTACGTCCATCTTAAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-itgb1b

Expressed Gene	Anatomy	Figures
sox32	forerunner cell group	Fig. 4 from Ablooglu et al., 2010
spaw	lateral plate mesoderm right side	Fig. 4 from Ablooglu et al., 2010
tbxta	axis forerunner cell group	Fig. 4 from Ablooglu et al., 2010

Phenotype

Phenotype resulting from MO2-itgb1b

Phenotype	Fish	Figures
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal	WT + MO2-itgb1b	Fig. 4 from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal	WT + MO2-itgb1b	Fig. 4 from Ablooglu et al., 2010
head morphology, abnormal	WT + MO2-itgb1b	Fig. 4 from Ablooglu et al., 2010
Kupffer's vesicle decreased volume, abnormal	WT + MO2-itgb1b	Fig. 7 from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO2-itgb1b	Fig. 7 from Ablooglu et al., 2010
pericardium edematous, abnormal	WT + MO2-itgb1b	Fig. 4 from Ablooglu et al., 2010
post-vent region undulate, abnormal	WT + MO2-itgb1b	Fig. 4 from Ablooglu et al., 2010
somite U-shaped, abnormal	WT + MO2-itgb1b	Fig. 4 from Ablooglu et al., 2010
ventricular system increased accumulation cerebral spinal fluid, abnormal	WT + MO2-itgb1b	Fig. 4 from Ablooglu et al., 2010

Phenotype of all Fish created by or utilizing MO2-itgb1b

Phenotype	Fish	Conditions	Figures
somite U-shaped, abnormal	WT + MO2-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal	WT + MO2-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
post-vent region undulate, abnormal	WT + MO2-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
pericardium edematous, abnormal	WT + MO2-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
Kupffer's vesicle decreased volume, abnormal	WT + MO2-itgb1b	standard conditions	Fig. 7 from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO2-itgb1b	standard conditions	Fig. 7 from Ablooglu et al., 2010
head morphology, abnormal	WT + MO2-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal	WT + MO2-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010
ventricular system increased accumulation cerebral spinal fluid, abnormal	WT + MO2-itgb1b	standard conditions	Fig. 4 from Ablooglu et al., 2010

Citations