Morpholino
MO2-myb
- ID
- ZDB-MRPHLNO-101015-3
- Name
- MO2-myb
- Previous Names
-
- MO2-cmyb
- Target
- Sequence
-
5' - TCGCCATCCCGCTGTTCGAGAGGAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-myb
No data available
Phenotype
Phenotype resulting from MO2-myb
| Phenotype | Fish | Figures |
|---|---|---|
| pro-T cell absent, abnormal | fr101Tg + MO2-myb |
Fig. 2 
from Soza-Ried et al., 2010 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-myb
1 - 5 of 5
Citations
- Jia-Xin, H., Song'en, X., Wen-Qing, Z., Wei, L. (2024) The interaction of Pu.1 and cMyb in zebrafish neutrophil development. Yi chuan = Hereditas. 46:319332319-332
- Chang, Y., Syahirah, R., Oprescu, S.N., Wang, X., Jung, J., Cooper, S.H., Torregrosa-Allen, S., Elzey, B.D., Hsu, A.Y., Randolph, L.N., Sun, Y., Kuang, S., Broxmeyer, H.E., Deng, Q., Lian, X., Bao, X. (2022) Chemically-defined generation of human hemogenic endothelium and definitive hematopoietic progenitor cells. Biomaterials. 285:121569
- Ye, Y., Yang, X., Li, F., Liu, W., Zhang, W., Huang, Z. (2022) c-myb is involved in CML progression and is a therapeutic target in the zebrafish CML model. Animal models and experimental medicine. 7(2):136-144
- Li, D., Xue, W., Li, M., Dong, M., Wang, J., Wang, X., Li, X., Chen, K., Zhang, W., Wu, S., Zhang, Y., Gao, L., Chen, Y., Chen, J., Zhou, B.O., Zhou, Y., Yao, X., Li, L., Wu, D., Pan, W. (2018) VCAM-1+ macrophages guide the homing of HSPCs to a vascular niche. Nature. 564(7734):119-124
- Gore, A.V., Athans, B., Iben, J.R., Johnson, K., Russanova, V., Castranova, D., Pham, V.N., Butler, M.G., Williams-Simons, L., Nichols, J.T., Bresciani, E., Feldman, B., Kimmel, C.B., Liu, P.P., Weinstein, B.M. (2016) Epigenetic regulation of hematopoiesis by DNA methylation. eLIFE. 5:e11813
- Jin, H., Huang, Z., Chi, Y., Wu, M., Zhou, R., Zhao, L., Xu, J., Zhen, F., Lan, Y., Li, L., Zhang, W., Wen, Z., Zhang, Y. (2016) cMyb acts in parallel and cooperatively with Cebp1 to regulate neutrophil maturation in zebrafish. Blood. 128(3):415-26
- Wang, L., Fu, C., Fan, H., Du, T., Dong, M., Chen, Y., Jin, Y., Zhou, Y., Deng, M., Gu, A., Jing, Q., Liu, T., and Zhou, Y. (2013) miR-34b regulates multiciliogenesis during organ formation in zebrafish. Development (Cambridge, England). 140(13):2755-2764
- Soza-Ried, C., Hess, I., Netuschil, N., Schorpp, M., and Boehm, T. (2010) Essential role of c-myb in definitive hematopoiesis is evolutionarily conserved. Proceedings of the National Academy of Sciences of the United States of America. 107(40):17304-17308
1 - 8 of 8
Show