Morpholino
MO2-plk2b
- ID
- ZDB-MRPHLNO-100908-4
- Name
- MO2-plk2b
- Previous Names
-
- plk2 sMO (1)
- Target
- Sequence
-
5' - TATGCAGTGTTTATCCTACCTTCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-plk2b
No data available
Phenotype
Phenotype resulting from MO2-plk2b
Phenotype of all Fish created by or utilizing MO2-plk2b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| intersegmental vessel hypoplastic, abnormal | s896Tg + MO2-plk2b | control |
Fig. 2 
from Yang et al., 2015 |
| sprouting angiogenesis decreased occurrence, abnormal | s896Tg + MO2-plk2b | control |
Fig. 2
from Yang et al., 2015 |
| dorsal longitudinal anastomotic vessel aplastic/hypoplastic, abnormal | s896Tg + MO2-plk2b | control |
Fig. 2
from Yang et al., 2015 |
| intersegmental vessel decreased length, abnormal | s896Tg + MO2-plk2b | control |
Fig. 2
from Yang et al., 2015 |
Citations
- Yang, H., Fang, L., Zhan, R., Hegarty, J.M., Ren, J., Hsiai, T.K., Gleeson, J.G., Miller, Y.I., Trejo, J., Chi, N.C. (2015) Polo-like kinase 2 regulates angiogenic sprouting and blood vessel development. Developmental Biology. 404(2):49-60
- Jeong, K., Jeong, J.Y., Lee, H.O., Choi, E., and Lee, H. (2010) Inhibition of Plk1 induces mitotic infidelity and embryonic growth defects in developing zebrafish embryos. Developmental Biology. 345(1):34-48
1 - 2 of 2
Show