ZFIN ID: ZDB-MRPHLNO-100907-1
Morpholino Name: MO4-itga2b
Target: itga2b (1)
Previous Names: alpha2-MO (1), integrin alpha2 MO (1), MO1-si:dkey-27b3.6 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCAGTAGAATCACAGCCTTTTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-itga2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-itga2b No data available
PHENOTYPE
Phenotype resulting from MO4-itga2b
Phenotype of all Fish created by or utilizing MO4-itga2b
Genome Resources:
CITATIONS (2)