Morpholino

MO4-itga2b

ID

ZDB-MRPHLNO-100907-1

Name

MO4-itga2b

Previous Names

Target

Sequence

5' - CCAGTAGAATCACAGCCTTTTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-itga2b

No data available

Phenotype

Phenotype resulting from MO4-itga2b

Phenotype	Fish	Figures
angiogenesis disrupted, abnormal	y7Tg + MO4-itga2b	Fig. 7 from San Antonio et al., 2009
blood vessel endothelial cell decreased amount, abnormal	y7Tg + MO4-itga2b	Fig. 7, Fig. S8 from San Antonio et al., 2009
caudal vein plexus branchiness, abnormal	y7Tg + MO4-itga2b	Fig. 7 from San Antonio et al., 2009
caudal vein plexus morphology, abnormal	y7Tg + MO4-itga2b	Fig. 7 from San Antonio et al., 2009
intersegmental vein physical quality, abnormal	y7Tg + MO4-itga2b	Fig. 7 from San Antonio et al., 2009
post-vent region curled, abnormal	WT + MO4-itga2b	Fig. 7 from San Antonio et al., 2009
subintestinal vein aplastic, abnormal	WT + MO4-itga2b	Fig. 8 from San Antonio et al., 2009
whole organism kinked, abnormal	WT + MO4-itga2b	Fig. 7 from San Antonio et al., 2009

Phenotype of all Fish created by or utilizing MO4-itga2b

Phenotype	Fish	Conditions	Figures
whole organism kinked, abnormal	WT + MO4-itga2b	standard conditions	Fig. 7 from San Antonio et al., 2009
post-vent region curled, abnormal	WT + MO4-itga2b	standard conditions	Fig. 7 from San Antonio et al., 2009
subintestinal vein aplastic, abnormal	WT + MO4-itga2b	standard conditions	Fig. 8 from San Antonio et al., 2009
post-vent region curled, abnormal	y7Tg + MO4-itga2b	standard conditions	Fig. 7 from San Antonio et al., 2009
caudal vein plexus morphology, abnormal	y7Tg + MO4-itga2b	standard conditions	Fig. 7 from San Antonio et al., 2009
blood vessel endothelial cell decreased amount, abnormal	y7Tg + MO4-itga2b	standard conditions	Fig. 7, Fig. S8 from San Antonio et al., 2009
whole organism kinked, abnormal	y7Tg + MO4-itga2b	standard conditions	Fig. 7 from San Antonio et al., 2009
caudal vein plexus branchiness, abnormal	y7Tg + MO4-itga2b	standard conditions	Fig. 7 from San Antonio et al., 2009
angiogenesis disrupted, abnormal	y7Tg + MO4-itga2b	standard conditions	Fig. 7 from San Antonio et al., 2009
intersegmental vein physical quality, abnormal	y7Tg + MO4-itga2b	standard conditions	Fig. 7 from San Antonio et al., 2009

Citations