Morpholino
MO1-adcy1b
- ID
- ZDB-MRPHLNO-100805-5
- Name
- MO1-adcy1b
- Previous Names
-
- zadcy1b MOE4 (1)
- Target
- Sequence
-
5' - AAACAAGATGCTGGAAAACACACAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adcy1b
No data available
Phenotype
Phenotype resulting from MO1-adcy1b
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-adcy1b
1 - 5 of 5
Citations
- Santos-Cortez, R.L., Lee, K., Giese, A.P., Ansar, M., Amin-Ud-Din, M., Rehn, K., Wang, X., Aziz, A., Chiu, I., Hussain Ali, R., Smith, J.D., Shendure, J., Bamshad, M., Nickerson, D.A., Ahmed, Z.M., Ahmad, W., Riazuddin, S., and Leal, S.M. (2014) Adenylate cyclase 1 (ADCY1) mutations cause recessive hearing impairment in humans and defects in hair cell function and hearing in zebrafish. Human molecular genetics. 23(12):3289-98
- Xu, H., Leinwand, S.G., Dell, A.L., Fried-Cassorla, E., and Raper, J.A. (2010) The Calmodulin-Stimulated Adenylate Cyclase ADCY8 Sets the Sensitivity of Zebrafish Retinal Axons to Midline Repellents and Is Required for Normal Midline Crossing. The Journal of neuroscience : the official journal of the Society for Neuroscience. 30(21):7423-7433
1 - 2 of 2
Show