header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100629-5
Morpholino Name: MO1-pigu
Target: pigu (1)
Sequence:
5' - AGTGTTAAAGGAGCCGCCATTTTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pigu No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pigu
Expressed Gene Anatomy Figures
scn1bb Fig. 6 with image from Nakano et al., 2010
PHENOTYPE
Phenotype resulting from MO1-pigu
Phenotype of all Fish created by or utilizing MO1-pigu
OTHER MO1-pigu MORPHOLINO PAGESNo links to external sites
CITATIONS (1)