Morpholino

MO1-col6a1

ID
ZDB-MRPHLNO-100623-5
Name
MO1-col6a1
Previous Names
  • Exon 9 col6a1 (1)
Target
Sequence
5' - GAGAGCGGAAGACGAACCTTCATTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-col6a1
No data available
Phenotype
Phenotype resulting from MO1-col6a1
Phenotype Fish Figures
horizontal myoseptum Ab2-col6 labeling decreased amount, abnormal AB/TU + MO1-col6a1 Figure S3 from Tonelotto et al., 2019
larval locomotory behavior decreased process quality, abnormal WT + MO1-col6a1 Figure 6 with image from La Spina et al., 2021
muscle muscle tendon junction disorganized, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle muscle tendon junction morphology, abnormal WT + MO1-col6a1 Fig. 1 from Zulian et al., 2014
muscle myofibril disorganized, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle T-tubule dilated, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle cell apoptotic, abnormal AB + MO1-col6a1 Fig. 7 from Telfer et al., 2010
muscle cell mitochondrial crista decreased amount, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle cell mitochondrial intermembrane space dilated, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle cell mitochondrion aggregated, abnormal WT + MO1-col6a1 Fig. 1 from Zulian et al., 2014
muscle cell mitochondrion increased size, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
muscle cell myofibril kinked, abnormal WT + MO1-col6a1 Fig. 1 from Zulian et al., 2014
muscle cell myofibril misaligned with muscle cell myofibril, abnormal WT + MO1-col6a1 Fig. 1 from Zulian et al., 2014
muscle cell myofibril separated from muscle cell muscle tendon junction, abnormal WT + MO1-col6a1 Fig. 5 from Zulian et al., 2014
musculoskeletal movement disrupted, abnormal AB + MO1-col6a1 Fig. 1Fig. 8 from Telfer et al., 2010
myotome muscle tendon junction structure, abnormal AB + MO1-col6a1 Fig. 4Fig. 6 from Telfer et al., 2010
pericardium edematous, abnormal AB + MO1-col6a1 Fig. 2 from Telfer et al., 2010
post-vent region bent, abnormal AB + MO1-col6a1 Fig. 2 from Telfer et al., 2010
skeletal muscle morphology, abnormal AB + MO1-col6a1 Fig. 4 from Telfer et al., 2010
skeletal muscle refractivity, abnormal WT + MO1-col6a1 Fig. 4 from Zulian et al., 2014
skeletal muscle cell collagen trimer spatial pattern, abnormal AB + MO1-col6a1 Fig. 3 from Telfer et al., 2010
skeletal muscle cell endoplasmic reticulum dilated, abnormal AB + MO1-col6a1 Fig. 5Fig. 9 from Telfer et al., 2010
skeletal muscle cell mitochondrial crista structure, abnormal AB + MO1-col6a1 Fig. 5 from Telfer et al., 2010
skeletal muscle cell mitochondrion increased amount, abnormal AB + MO1-col6a1 Fig. 6 from Telfer et al., 2010
skeletal muscle cell mitochondrion swollen, abnormal AB + MO1-col6a1 Fig. 5Fig. 9 from Telfer et al., 2010
skeletal muscle cell myofibril structure, abnormal AB + MO1-col6a1 Fig. 10 from Telfer et al., 2010
skeletal muscle cell sarcolemma structure, abnormal AB + MO1-col6a1 Fig. 4 from Telfer et al., 2010
startle response disrupted, abnormal AB + MO1-col6a1 Fig. 1 from Telfer et al., 2010
thigmotaxis decreased process quality, abnormal WT + MO1-col6a1 Figure 6 with image from La Spina et al., 2021
thigmotaxis disrupted, abnormal WT + MO1-col6a1 Fig. 3 from Zulian et al., 2014
trunk bent, abnormal WT + MO1-col6a1 Fig. 1 from Zulian et al., 2014
Fig. 2 from Telfer et al., 2010
trunk skeletal muscle organization quality, abnormal WT + MO1-col6a1 Figure 6 with image from La Spina et al., 2021
vertical myoseptum Ab2-col6 labeling decreased amount, abnormal AB/TU + MO1-col6a1 Figure S3 from Tonelotto et al., 2019
whole organism decreased mobility, abnormal WT + MO1-col6a1 Fig. 2 from Zulian et al., 2014
whole organism decreased size, abnormal AB + MO1-col6a1 Fig. 1 from Zulian et al., 2014
Fig. 2 from Telfer et al., 2010
whole organism hypoplastic, abnormal AB + MO1-col6a1 Fig. 2 from Telfer et al., 2010
whole organism paralysed, abnormal WT + MO1-col6a1 Fig. 2 from Zulian et al., 2014
Phenotype of all Fish created by or utilizing MO1-col6a1
Phenotype Fish Conditions Figures
pericardium edematous, abnormal AB + MO1-col6a1 standard conditions Fig. 2 from Telfer et al., 2010
skeletal muscle cell sarcolemma structure, abnormal AB + MO1-col6a1 standard conditions Fig. 4 from Telfer et al., 2010
skeletal muscle cell myofibril structure, abnormal AB + MO1-col6a1 chemical treatment: cyclosporin A Fig. 10 from Telfer et al., 2010
musculoskeletal movement disrupted, abnormal AB + MO1-col6a1 chemical treatment: cyclosporin A Fig. 8 from Telfer et al., 2010
skeletal muscle cell mitochondrion increased amount, abnormal AB + MO1-col6a1 standard conditions Fig. 6 from Telfer et al., 2010
myotome muscle tendon junction structure, abnormal AB + MO1-col6a1 standard conditions Fig. 4Fig. 6 from Telfer et al., 2010
skeletal muscle cell collagen trimer spatial pattern, abnormal AB + MO1-col6a1 standard conditions Fig. 3 from Telfer et al., 2010
skeletal muscle morphology, abnormal AB + MO1-col6a1 standard conditions Fig. 4 from Telfer et al., 2010
whole organism decreased size, abnormal AB + MO1-col6a1 standard conditions Fig. 2 from Telfer et al., 2010
skeletal muscle cell mitochondrial crista structure, abnormal AB + MO1-col6a1 standard conditions Fig. 5 from Telfer et al., 2010
post-vent region bent, abnormal AB + MO1-col6a1 standard conditions Fig. 2 from Telfer et al., 2010
musculoskeletal movement disrupted, abnormal AB + MO1-col6a1 standard conditions Fig. 1Fig. 8 from Telfer et al., 2010
startle response disrupted, abnormal AB + MO1-col6a1 standard conditions Fig. 1 from Telfer et al., 2010
skeletal muscle cell mitochondrion swollen, abnormal AB + MO1-col6a1 standard conditions Fig. 5Fig. 9 from Telfer et al., 2010
skeletal muscle cell myofibril structure, abnormal AB + MO1-col6a1 standard conditions Fig. 10 from Telfer et al., 2010
whole organism hypoplastic, abnormal AB + MO1-col6a1 standard conditions Fig. 2 from Telfer et al., 2010
trunk bent, abnormal AB + MO1-col6a1 standard conditions Fig. 2 from Telfer et al., 2010
skeletal muscle cell endoplasmic reticulum dilated, abnormal AB + MO1-col6a1 standard conditions Fig. 5Fig. 9 from Telfer et al., 2010
muscle cell apoptotic, abnormal AB + MO1-col6a1 standard conditions Fig. 7 from Telfer et al., 2010
muscle cell apoptotic, abnormal AB + MO1-col6a1 + MO4-tp53 chemical treatment: cyclosporin A Fig. 7 from Telfer et al., 2010
musculoskeletal movement disrupted, abnormal AB + MO1-col6a1 + MO4-tp53 standard conditions Fig. 8 from Telfer et al., 2010
muscle cell apoptotic, abnormal AB + MO1-col6a1 + MO4-tp53 standard conditions Fig. 7 from Telfer et al., 2010
vertical myoseptum Ab2-col6 labeling decreased amount, abnormal AB/TU + MO1-col6a1 standard conditions Figure S3 from Tonelotto et al., 2019
horizontal myoseptum Ab2-col6 labeling decreased amount, abnormal AB/TU + MO1-col6a1 standard conditions Figure S3 from Tonelotto et al., 2019
skeletal muscle refractivity, abnormal WT + MO1-col6a1 standard conditions Fig. 4 from Zulian et al., 2014
muscle muscle tendon junction disorganized, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
trunk bent, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
larval locomotory behavior decreased process quality, abnormal WT + MO1-col6a1 control Figure 6 with image from La Spina et al., 2021
muscle cell mitochondrial intermembrane space dilated, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
muscle cell mitochondrion aggregated, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
muscle myofibril disorganized, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
muscle muscle tendon junction morphology, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
thigmotaxis disrupted, abnormal WT + MO1-col6a1 standard conditions Fig. 3 from Zulian et al., 2014
thigmotaxis process quality, ameliorated WT + MO1-col6a1 chemical treatment by environment: pterostilbene Figure 6 with image from La Spina et al., 2021
muscle cell myofibril kinked, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
muscle cell mitochondrion increased size, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
trunk skeletal muscle organization quality, ameliorated WT + MO1-col6a1 chemical treatment by environment: pterostilbene Figure 6 with image from La Spina et al., 2021
larval locomotory behavior process quality, ameliorated WT + MO1-col6a1 chemical treatment by environment: pterostilbene Figure 6 with image from La Spina et al., 2021
whole organism paralysed, abnormal WT + MO1-col6a1 standard conditions Fig. 2 from Zulian et al., 2014
muscle cell mitochondrial crista decreased amount, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
trunk skeletal muscle organization quality, abnormal WT + MO1-col6a1 control Figure 6 with image from La Spina et al., 2021
muscle T-tubule dilated, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
whole organism decreased mobility, abnormal WT + MO1-col6a1 standard conditions Fig. 2 from Zulian et al., 2014
muscle cell myofibril separated from muscle cell muscle tendon junction, abnormal WT + MO1-col6a1 standard conditions Fig. 5 from Zulian et al., 2014
muscle cell myofibril misaligned with muscle cell myofibril, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
thigmotaxis decreased process quality, abnormal WT + MO1-col6a1 control Figure 6 with image from La Spina et al., 2021
whole organism decreased size, abnormal WT + MO1-col6a1 standard conditions Fig. 1 from Zulian et al., 2014
Citations