Morpholino
MO1-col6a1
- ID
- ZDB-MRPHLNO-100623-5
- Name
- MO1-col6a1
- Previous Names
-
- Exon 9 col6a1 (1)
- Target
- Sequence
-
5' - GAGAGCGGAAGACGAACCTTCATTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-col6a1
No data available
Phenotype
Phenotype resulting from MO1-col6a1
1 - 5 of 37 Show all
Phenotype of all Fish created by or utilizing MO1-col6a1
1 - 5 of 47 Show all
Citations
- La Spina, M., Azzolini, M., Salmaso, A., Parrasia, S., Galletta, E., Schiavone, M., Chrisam, M., Mattarei, A., Di Benedetto, G., Ballabio, A., Tiso, N., Zoratti, M., Biasutto, L. (2021) Multiple Mechanisms Converging on Transcription Factor EB Activation by the Natural Phenol Pterostilbene. Oxidative medicine and cellular longevity. 2021:7658501
- Tonelotto, V., Trapani, V., Bretaud, S., Heumüller, S.E., Wagener, R., Ruggiero, F., Bonaldo, P. (2019) Spatio-temporal expression and distribution of collagen VI during zebrafish development. Scientific Reports. 9:19851
- Roy, S., Šileikytė, J., Schiavone, M., Neuenswander, B., Argenton, F., Aubé, J., Hedrick, M.P., Chung, T.D., Forte, M.A., Bernardi, P., Schoenen, F.J. (2015) Discovery, Synthesis, and Optimization of Diarylisoxazole-3-carboxamides as Potent Inhibitors of the Mitochondrial Permeability Transition Pore. ChemMedChem. 10(10):1655-71
- Zulian, A., Rizzo, E., Schiavone, M., Palma, E., Tagliavini, F., Blaauw, B., Merlini, L., Maraldi, N.M., Sabatelli, P., Braghetta, P., Bonaldo, P., Argenton, F., Bernardi, P. (2014) NIM811, a cyclophilin inhibitor without immunosuppressive activity, is beneficial in collagen VI congenital muscular dystrophy models. Human molecular genetics. 23(20):5353-63
- Telfer, W.R., Busta, A.S., Bonnemann, C.G., Feldman, E.L., and Dowling, J.J. (2010) Zebrafish Models of Collagen VI Related Myopathies. Human molecular genetics. 19(12):2433-2444
1 - 5 of 5
Show