header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100621-9
Morpholino Name: MO1-fgf2
Target: fgf2 (1)
Sequence:
5' - GGCCATCCCTAAGTCTGTCGGTCTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fgf2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fgf2
Expressed Gene Anatomy Figures
sdc2 Fig. S2 with image from Arrington et al., 2013
tbx16 Fig. S2 with image from Arrington et al., 2013
PHENOTYPE
Phenotype resulting from MO1-fgf2
Phenotype of all Fish created by or utilizing MO1-fgf2
OTHER MO1-fgf2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)