Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-akt2

ID
ZDB-MRPHLNO-100621-7
Name
MO1-akt2
Previous Names
None
Target
Sequence
5' - CTCTGACGACGCTGATCTCGTTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-akt2
Phenotype
Phenotype resulting from MO1-akt2
Phenotype of all Fish created by or utilizing MO1-akt2
Citations