Morpholino

MO5-pax6b

ID
ZDB-MRPHLNO-100610-4
Name
MO5-pax6b
Previous Names
  • MO2Pax6b
Target
Sequence
5' - TTGATTTGCACTCACGCTCGGTATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-pax6b
Expressed Gene Anatomy Figures
gcga Fig. 6,  Fig. 7,  Fig. S1 from Verbruggen et al., 2010
ghrl Fig. 6,  Fig. 7,  Fig. S1 from Verbruggen et al., 2010
ins Fig. 3,  Fig. 5,  Fig. 6,  Fig. 7,  Fig. S1 from Verbruggen et al., 2010
mnx1 Fig. 6 with image from Arkhipova et al., 2012
pax6a Fig. 1 from Verbruggen et al., 2010
pax6b Fig. 1 from Verbruggen et al., 2010
sst2 Fig. 6,  Fig. 7,  Fig. S1 from Verbruggen et al., 2010
Phenotype
Phenotype resulting from MO5-pax6b
Phenotype Fish Figures
D cell decreased amount, abnormal AB + MO5-pax6b Fig. 1,  Fig. 6,  Fig. 7,  Fig. S1 from Verbruggen et al., 2010
endocrine pancreas peptide hormone secreting cell increased amount, abnormal AB + MO5-pax6b Fig. 1,  Fig. 6,  Fig. 7 from Verbruggen et al., 2010
lens aplastic, abnormal AB + MO5-pax6b Fig. 5 from Verbruggen et al., 2010
lens decreased size, abnormal m1018Tg; ulg515Tg + MO5-pax6b Fig. 3 from Verbruggen et al., 2010
lens morphogenesis in camera-type eye arrested, abnormal AB + MO5-pax6b Fig. 5 from Verbruggen et al., 2010
lens morphogenesis in camera-type eye disrupted, abnormal m1018Tg; ulg515Tg + MO5-pax6b Fig. 3 from Verbruggen et al., 2010
pancreatic A cell decreased amount, abnormal AB + MO5-pax6b Fig. 7 from Verbruggen et al., 2010
pancreatic A cell increased amount, abnormal AB + MO5-pax6b Fig. 7 from Verbruggen et al., 2010
pancreatic B cell decreased amount, abnormal AB + MO5-pax6b Fig. 1,  Fig. 3,  Fig. 5,  Fig. 6,  Fig. 7,  Fig. S1 from Verbruggen et al., 2010
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; ulg515Tg + MO5-pax6b Fig. 1,  Fig. 3,  Fig. 5,  Fig. S1 from Verbruggen et al., 2010
Phenotype of all Fish created by or utilizing MO5-pax6b
Phenotype Fish Conditions Figures
pancreatic B cell decreased amount, abnormal AB + MO5-pax6b standard conditions Fig. 1,  Fig. 5,  Fig. 6,  Fig. 7,  Fig. S1 from Verbruggen et al., 2010
type B pancreatic cell differentiation disrupted, abnormal AB + MO5-pax6b standard conditions Fig. 1,  Fig. 5,  Fig. S1 from Verbruggen et al., 2010
pancreatic A cell increased amount, abnormal AB + MO5-pax6b standard conditions Fig. 7 from Verbruggen et al., 2010
endocrine pancreas peptide hormone secreting cell increased amount, abnormal AB + MO5-pax6b standard conditions Fig. 1,  Fig. 6,  Fig. 7 from Verbruggen et al., 2010
lens aplastic, abnormal AB + MO5-pax6b standard conditions Fig. 5 from Verbruggen et al., 2010
D cell decreased amount, abnormal AB + MO5-pax6b standard conditions Fig. 1,  Fig. 6,  Fig. 7,  Fig. S1 from Verbruggen et al., 2010
pancreatic A cell decreased amount, abnormal AB + MO5-pax6b standard conditions Fig. 7 from Verbruggen et al., 2010
lens morphogenesis in camera-type eye arrested, abnormal AB + MO5-pax6b standard conditions Fig. 5 from Verbruggen et al., 2010
lens morphogenesis in camera-type eye arrested, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 5 from Verbruggen et al., 2010
lens aplastic, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 5 from Verbruggen et al., 2010
pancreatic B cell absent, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 5,  Fig. 6 from Verbruggen et al., 2010
type B pancreatic cell differentiation disrupted, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 5 from Verbruggen et al., 2010
endocrine pancreas peptide hormone secreting cell increased amount, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 6 from Verbruggen et al., 2010
D cell decreased amount, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 6 from Verbruggen et al., 2010
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; ulg515Tg + MO5-pax6b standard conditions Fig. 3 from Verbruggen et al., 2010
lens decreased size, abnormal m1018Tg; ulg515Tg + MO5-pax6b standard conditions Fig. 3 from Verbruggen et al., 2010
lens morphogenesis in camera-type eye disrupted, abnormal m1018Tg; ulg515Tg + MO5-pax6b standard conditions Fig. 3 from Verbruggen et al., 2010
pancreatic B cell decreased amount, abnormal m1018Tg; ulg515Tg + MO5-pax6b standard conditions Fig. 3 from Verbruggen et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.