ZFIN ID: ZDB-MRPHLNO-100610-4
Morpholino Name: MO5-pax6b
Target: pax6b (1)
Previous Name: MO2Pax6b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTGATTTGCACTCACGCTCGGTATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-pax6b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-pax6b
Expressed Gene Anatomy Figures
gcga Fig. 6Fig. 7Fig. S1 from Verbruggen et al., 2010
ghrl Fig. 6Fig. 7Fig. S1 from Verbruggen et al., 2010
ins Fig. 3Fig. 5Fig. 6Fig. 7Fig. S1 from Verbruggen et al., 2010
mnx1 Fig. 6 with image from Arkhipova et al., 2012
pax6a Fig. 1 from Verbruggen et al., 2010
pax6b Fig. 1 from Verbruggen et al., 2010
sst2 Fig. 6Fig. 7Fig. S1 from Verbruggen et al., 2010
PHENOTYPE
Phenotype resulting from MO5-pax6b
Phenotype of all Fish created by or utilizing MO5-pax6b
Phenotype Fish Conditions Figures
pancreatic B cell decreased amount, abnormal AB + MO5-pax6b standard conditions Fig. 1Fig. 5Fig. 6Fig. 7Fig. S1 from Verbruggen et al., 2010
type B pancreatic cell differentiation disrupted, abnormal AB + MO5-pax6b standard conditions Fig. 1Fig. 5Fig. S1 from Verbruggen et al., 2010
pancreatic A cell increased amount, abnormal AB + MO5-pax6b standard conditions Fig. 7 from Verbruggen et al., 2010
lens aplastic, abnormal AB + MO5-pax6b standard conditions Fig. 5 from Verbruggen et al., 2010
endocrine pancreas peptide hormone secreting cell increased amount, abnormal AB + MO5-pax6b standard conditions Fig. 1Fig. 6Fig. 7 from Verbruggen et al., 2010
D cell decreased amount, abnormal AB + MO5-pax6b standard conditions Fig. 1Fig. 6Fig. 7Fig. S1 from Verbruggen et al., 2010
pancreatic A cell decreased amount, abnormal AB + MO5-pax6b standard conditions Fig. 7 from Verbruggen et al., 2010
lens morphogenesis in camera-type eye arrested, abnormal AB + MO5-pax6b standard conditions Fig. 5 from Verbruggen et al., 2010
lens morphogenesis in camera-type eye arrested, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 5 from Verbruggen et al., 2010
lens aplastic, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 5 from Verbruggen et al., 2010
pancreatic B cell absent, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 5Fig. 6 from Verbruggen et al., 2010
type B pancreatic cell differentiation disrupted, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 5 from Verbruggen et al., 2010
endocrine pancreas peptide hormone secreting cell increased amount, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 6 from Verbruggen et al., 2010
D cell decreased amount, abnormal AB + MO5-pax6b + MO8-pax6b standard conditions Fig. 6 from Verbruggen et al., 2010
type B pancreatic cell differentiation disrupted, abnormal m1018Tg; ulg515Tg + MO5-pax6b standard conditions Fig. 3 from Verbruggen et al., 2010
lens decreased size, abnormal m1018Tg; ulg515Tg + MO5-pax6b standard conditions Fig. 3 from Verbruggen et al., 2010
lens morphogenesis in camera-type eye disrupted, abnormal m1018Tg; ulg515Tg + MO5-pax6b standard conditions Fig. 3 from Verbruggen et al., 2010
pancreatic B cell decreased amount, abnormal m1018Tg; ulg515Tg + MO5-pax6b standard conditions Fig. 3 from Verbruggen et al., 2010
Genome Resources:
CITATIONS (2)