ZFIN ID: ZDB-MRPHLNO-100610-3
Morpholino Name: MO4-pax6b
Target: pax6b (1)
Previous Name: MO1Pax6b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGCTTCACAAGTCACCTGCAAAATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-pax6b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-pax6b
Expressed Gene Anatomy Figures
gcga Fig. 6 from Verbruggen et al., 2010
ghrl Fig. 6 from Verbruggen et al., 2010
ins Fig. 6 from Verbruggen et al., 2010
sst2 Fig. 6 from Verbruggen et al., 2010
PHENOTYPE
Phenotype resulting from MO4-pax6b
Phenotype of all Fish created by or utilizing MO4-pax6b
Genome Resources:
CITATIONS (1)