Morpholino

MO1-coil

ID
ZDB-MRPHLNO-100608-7
Name
MO1-coil
Previous Names
None
Target
Sequence
5' - GCCATGCCTGAACACTACACTACAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-coil
Expressed Gene Anatomy Figures
coil Fig. 2 from Strzelecka et al., 2010
Phenotype
Phenotype resulting from MO1-coil
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-coil Fig. S2 from Strzelecka et al., 2010
Cajal body organization decreased process quality, abnormal WT + MO1-coil Fig. 2,  Fig. 3 from Strzelecka et al., 2010
cell Cajal body decreased amount, abnormal WT + MO1-coil Fig. 2,  Fig. 3 from Strzelecka et al., 2010
cell small nuclear ribonucleoprotein complex dispersed, abnormal WT + MO1-coil Fig. 2,  Fig. 3 from Strzelecka et al., 2010
cell population proliferation decreased occurrence, abnormal WT + MO1-coil Fig. S2 from Strzelecka et al., 2010
embryo development arrested, abnormal WT + MO1-coil Fig. 1 from Strzelecka et al., 2010
mRNA cis splicing, via spliceosome decreased occurrence, abnormal WT + MO1-coil Fig. 4 from Strzelecka et al., 2010
spliceosomal snRNP assembly decreased process quality, abnormal WT + MO1-coil Fig. 4 from Strzelecka et al., 2010
whole organism cell apoptotic, abnormal WT + MO1-coil Fig. S2 from Strzelecka et al., 2010
whole organism cell dead, abnormal WT + MO1-coil Fig. 1 from Strzelecka et al., 2010
Phenotype of all Fish created by or utilizing MO1-coil
Phenotype Fish Conditions Figures
Cajal body organization decreased process quality, abnormal WT + MO1-coil standard conditions Fig. 2,  Fig. 3 from Strzelecka et al., 2010
apoptotic process increased occurrence, abnormal WT + MO1-coil standard conditions Fig. S2 from Strzelecka et al., 2010
cell Cajal body decreased amount, abnormal WT + MO1-coil standard conditions Fig. 2,  Fig. 3 from Strzelecka et al., 2010
cell small nuclear ribonucleoprotein complex dispersed, abnormal WT + MO1-coil standard conditions Fig. 2,  Fig. 3 from Strzelecka et al., 2010
cell population proliferation decreased occurrence, abnormal WT + MO1-coil standard conditions Fig. S2 from Strzelecka et al., 2010
mRNA cis splicing, via spliceosome decreased occurrence, abnormal WT + MO1-coil standard conditions Fig. 4 from Strzelecka et al., 2010
spliceosomal snRNP assembly decreased process quality, abnormal WT + MO1-coil standard conditions Fig. 4 from Strzelecka et al., 2010
whole organism cell apoptotic, abnormal WT + MO1-coil standard conditions Fig. S2 from Strzelecka et al., 2010
embryo development arrested, abnormal WT + MO1-coil standard conditions Fig. 1 from Strzelecka et al., 2010
whole organism cell dead, abnormal WT + MO1-coil standard conditions Fig. 1 from Strzelecka et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.