Morpholino
MO2-sox19b
- ID
- ZDB-MRPHLNO-100527-8
- Name
- MO2-sox19b
- Previous Names
- None
- Target
- Sequence
-
5' - ACGAGCGAGCCTAATCAGGTCAAAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sox19b
No data available
Phenotype
Phenotype resulting from MO2-sox19b
No data available
Phenotype of all Fish created by or utilizing MO2-sox19b
Citations
- Gao, M., Veil, M., Rosenblatt, M., Riesle, A.J., Gebhard, A., Hass, H., Buryanova, L., Yampolsky, L.Y., Grüning, B., Ulianov, S.V., Timmer, J., Onichtchouk, D. (2022) Pluripotency factors determine gene expression repertoire at zygotic genome activation. Nature communications. 13:788
- Joseph, S.R., Pálfy, M., Hilbert, L., Kumar, M., Karschau, J., Zaburdaev, V., Shevchenko, A., Vastenhouw, N.L. (2017) Competition between histone and transcription factor binding regulates the onset of transcription in zebrafish embryos. eLIFE. 6
- Lee, M.T., Bonneau, A.R., Takacs, C.M., Bazzini, A.A., Divito, K.R., Fleming, E.S., and Giraldez, A.J. (2013) Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition. Nature. 503(7476):360-4
- Leichsenring, M., Maes, J., Mössner, R., Driever, W., and Onichtchouk, D. (2013) Pou5f1 transcription factor controls zygotic gene activation in vertebrates. Science (New York, N.Y.). 341(6149):1005-1009
- Okuda, Y., Ogura, E., Kondoh, H., and Kamachi, Y. (2010) B1 SOX coordinate cell specification with patterning and morphogenesis in the early zebrafish embryo. PLoS Genetics. 6:e1000936
1 - 5 of 5
Show