Morpholino

MO3-sox3

ID
ZDB-MRPHLNO-100527-3
Name
MO3-sox3
Previous Names
None
Target
Sequence
5' - TACATTCTTAAAAGTGGTGCCAAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sox3
Expressed Gene Anatomy Figures
pax2a Fig. 2 with image from Padanad et al., 2011
phox2a Fig. 2 with image from Padanad et al., 2011
Phenotype
Phenotype resulting from MO3-sox3
Phenotype Fish Figures
epibranchial ganglion decreased amount, abnormal AB + MO3-sox3 Fig. 2 with image from Padanad et al., 2011
otic placode pax2a expression decreased amount, abnormal AB + MO3-sox3 + MO4-tp53 Fig. 7 with image from Gou et al., 2018
otic placode pax2a expression decreased distribution, abnormal AB + MO3-sox3 + MO4-tp53 Fig. 7 with image from Gou et al., 2018
Phenotype of all Fish created by or utilizing MO3-sox3
Phenotype Fish Conditions Figures
epibranchial ganglion decreased amount, abnormal AB + MO3-sox3 standard conditions Fig. 2 with image from Padanad et al., 2011
otic placode pax2a expression decreased amount, abnormal AB + MO3-sox3 + MO4-tp53 standard conditions Fig. 7 with image from Gou et al., 2018
otic placode pax2a expression decreased distribution, abnormal AB + MO3-sox3 + MO4-tp53 standard conditions Fig. 7 with image from Gou et al., 2018
ectoderm pax8 expression mislocalised, abnormal x17Tg/+ + MO3-sox3 + MO4-tp53 (AB) heat shock Fig. 10 with image from Gou et al., 2018
otic placode pax8 expression increased distribution, abnormal x17Tg/+ + MO3-sox3 + MO4-tp53 (AB) heat shock Fig. 10 with image from Gou et al., 2018
otic placode pax8 expression spatial pattern, abnormal x17Tg/+ + MO3-sox3 + MO4-tp53 (AB) heat shock Fig. 10 with image from Gou et al., 2018
otic placode pax8 expression increased amount, abnormal x17Tg/+ + MO3-sox3 + MO4-tp53 (AB) heat shock Fig. 10 with image from Gou et al., 2018
whole organism lacks all parts of type facial ganglion, abnormal AB + MO3-sox3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Padanad et al., 2011
otic vesicle decreased size, abnormal AB + MO3-sox3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Padanad et al., 2011
whole organism lacks all parts of type glossopharyngeal ganglion, abnormal AB + MO3-sox3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Padanad et al., 2011
whole organism lacks all parts of type vagal ganglion 2, abnormal AB + MO3-sox3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Padanad et al., 2011
whole organism lacks all parts of type vagal ganglion 1, abnormal AB + MO3-sox3 + MO6-pax8 + MO7-pax8 standard conditions Fig. 2 with image from Padanad et al., 2011
caudal fin deformed, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox3 + MO4-sox3 standard conditions Fig. 1 with image from Okuda et al., 2010
central nervous system abnormal, abnormal WT + MO1-sox19a + MO2-sox19a + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image from Okuda et al., 2010
central nervous system abnormal, abnormal WT + MO1-sox19b + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image from Okuda et al., 2010
epiboly delayed, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
Fig. 1 with image from Okuda et al., 2010
whole organism wholly dorsalized, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 4 with image from Okuda et al., 2010
notochord broad, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
neurogenesis disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
convergent extension disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
mesoderm increased width, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 3 with image from Okuda et al., 2010
axis shortened, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
tail bud aplastic, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
somite malformed, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
whole organism truncated, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
central nervous system abnormal, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image from Okuda et al., 2010
neural plate increased width, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
neural plate development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 3 with image from Okuda et al., 2010
hindbrain development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 5 with image from Okuda et al., 2010
central nervous system development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
brain development disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 5 with image from Okuda et al., 2010
head aplastic, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
anterior neural plate formation disrupted, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 5 with image from Okuda et al., 2010
prechordal plate increased distance notochord, abnormal WT + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 1 with image,  Fig. 2 with image from Okuda et al., 2010
whole organism embryo development arrested, abnormal pou5f3m793/m793 + MO1-sox19a + MO1-sox19b + MO2-sox19a + MO2-sox19b + MO3-sox2 + MO3-sox3 + MO4-sox2 + MO4-sox3 standard conditions Fig. 2,  Fig. S8 from Leichsenring et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.