Community Action Needed: Please respond to the NIH RFI
Morpholino

MO5-cdh5

ID
ZDB-MRPHLNO-100520-10
Name
MO5-cdh5
Previous Names
None
Target
Sequence
5' - CCTCCTGGCACACTGTTTCATCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-cdh5
Phenotype
Phenotype resulting from MO5-cdh5
Phenotype of all Fish created by or utilizing MO5-cdh5
Phenotype Fish Conditions Figures
blood circulation disrupted, abnormal AB + MO5-cdh5 standard conditions Fig. 1 with imageFig. 2 with image from Mitchell et al., 2010
heart looping disrupted, abnormal AB + MO5-cdh5 standard conditions Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 4 with image from Mitchell et al., 2010
atrial endocardium structure, abnormal AB + MO5-cdh5 standard conditions Fig. 5 with imageFig. 7 with image from Mitchell et al., 2010
pericardium edematous, abnormal AB + MO5-cdh5 standard conditions Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 5 with image from Mitchell et al., 2010
sinus venosus increased accumulation blood, abnormal AB + MO5-cdh5 standard conditions Fig. 1 with image from Mitchell et al., 2010
atrium elongated, abnormal AB + MO5-cdh5 standard conditions Fig. 5 with image from Mitchell et al., 2010
cardiac ventricle elongated, abnormal AB + MO5-cdh5 standard conditions Fig. 4 with image from Mitchell et al., 2010
atrial myocardium contractility, abnormal AB + MO5-cdh5 standard conditions Fig. 7 with image from Mitchell et al., 2010
atrial endocardium cell-cell junction decreased amount, abnormal AB + MO5-cdh5 standard conditions Fig. 7 with image from Mitchell et al., 2010
cardiac jelly physical quality, abnormal AB + MO5-cdh5 standard conditions Fig. 7 with image from Mitchell et al., 2010
atrium dilated, abnormal AB + MO5-cdh5 standard conditions Fig. 1 with image from Mitchell et al., 2010
atrial endocardium cell-cell junction decreased size, abnormal AB + MO5-cdh5 standard conditions Fig. 7 with image from Mitchell et al., 2010
atrial endocardium structure, abnormal y1Tg + MO5-cdh5 standard conditions Fig. 6 with image from Mitchell et al., 2010
Citations