ZFIN ID: ZDB-MRPHLNO-100517-4
Morpholino Name: MO5-aldh1a2
Target: aldh1a2 (1)
Sequence:
5' - GTTCAACTTCACTGGAGGTCATCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-aldh1a2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-aldh1a2
Expressed Gene Anatomy Figures
gata1a Table 3 from Ma et al., 2010
hbae1.1 Table 3 from Ma et al., 2010
hoxb1b Fig. 3 with image from Cruz et al., 2010
lcp1 Table 3 from Ma et al., 2010
spi1b Table 3 from Ma et al., 2010
tal1 Table 3 from Ma et al., 2010
PHENOTYPE
Phenotype resulting from MO5-aldh1a2
Phenotype of all Fish created by or utilizing MO5-aldh1a2
Genome Resources:
CITATIONS (3)