Morpholino

MO1-tardbpb

ID
ZDB-MRPHLNO-100506-1
Name
MO1-tardbpb
Previous Names
  • AMO (1)
  • MO1-tardbp
Target
Sequence
5' - GTACATCTCGGCCATCTTTCCTCAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is the corrected sequence for the tardbp MO published in Hum. Mol. Genet. 19(4): 671-683.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tardbpb
Expressed Gene Anatomy Figures
ache Figure 2 with image from Campanari et al., 2021
chrna1 Figure 1 with image from Campanari et al., 2021
chrng Figure 1 with image from Campanari et al., 2021
hdac4 Figure 1 with image from Campanari et al., 2021
pls3 Fig. 1 from Hao et al., 2012
smn1 Fig. 1 from Hao et al., 2012
Phenotype
Phenotype resulting from MO1-tardbpb
Phenotype Fish Figures
acetylcholinesterase activity decreased process quality, abnormal WT + MO1-tardbpb Figure 2 with image from Campanari et al., 2021
axon extension process quality, abnormal ml2Tg + MO1-tardbpb Fig. 4 with image from Chitramuthu et al., 2017
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-tardbpb Fig. 4 with image,  Fig. 5 from Chitramuthu et al., 2017
locomotory behavior disrupted, abnormal WT + MO1-tardbpb Figure 3 with image from Campanari et al., 2021
Fig. 4,  Fig. 5 from Kabashi et al., 2010
locomotory behavior having decreased processual parts skeletal muscle contraction, abnormal WT + MO1-tardbpb Fig. 4,  Fig. 5 from Kabashi et al., 2010
motor neuron axon decreased length, abnormal WT + MO1-tardbpb Fig. 6 with image from Kabashi et al., 2011
neuromuscular junction development disrupted, abnormal WT + MO1-tardbpb Figure 1 with image,  Figure 3 with image from Campanari et al., 2021
peripheral neuron branchiness, abnormal WT + MO1-tardbpb Fig. 4,  Fig. 5 from Kabashi et al., 2010
peripheral neuron decreased length, abnormal WT + MO1-tardbpb Fig. 4,  Fig. 5 from Kabashi et al., 2010
regulation of RNA splicing disrupted, abnormal WT + MO1-tardbpb Fig. 6 from Demy et al., 2020
sensory perception of touch disrupted, abnormal WT + MO1-tardbpb Fig. 6 with image from Kabashi et al., 2011
skeletal muscle acetylcholine-gated channel clustering disrupted, abnormal WT + MO1-tardbpb Figure 1 with image from Campanari et al., 2021
thigmotaxis decreased process quality, abnormal ml2Tg + MO1-tardbpb Fig. 5 from Chitramuthu et al., 2017
thigmotaxis disrupted, abnormal WT + MO1-tardbpb Fig. 5 from Kabashi et al., 2010
whole organism ache expression decreased amount, abnormal WT + MO1-tardbpb Figure 2 with image from Campanari et al., 2021
whole organism chrna1 expression increased amount, abnormal WT + MO1-tardbpb Figure 1 with image from Campanari et al., 2021
Phenotype of all Fish created by or utilizing MO1-tardbpb
Phenotype Fish Conditions Figures
skeletal muscle acetylcholine-gated channel clustering disrupted, abnormal WT + MO1-tardbpb standard conditions Figure 1 with image from Campanari et al., 2021
locomotory behavior having decreased processual parts skeletal muscle contraction, abnormal WT + MO1-tardbpb standard conditions Fig. 4,  Fig. 5 from Kabashi et al., 2010
motor neuron axon decreased length, abnormal WT + MO1-tardbpb standard conditions Fig. 6 with image from Kabashi et al., 2011
whole organism chrna1 expression increased amount, abnormal WT + MO1-tardbpb standard conditions Figure 1 with image from Campanari et al., 2021
locomotory behavior disrupted, abnormal WT + MO1-tardbpb standard conditions Figure 3 with image from Campanari et al., 2021
Fig. 4,  Fig. 5 from Kabashi et al., 2010
peripheral neuron decreased length, abnormal WT + MO1-tardbpb standard conditions Fig. 4,  Fig. 5 from Kabashi et al., 2010
sensory perception of touch disrupted, abnormal WT + MO1-tardbpb standard conditions Fig. 6 with image from Kabashi et al., 2011
acetylcholinesterase activity decreased process quality, abnormal WT + MO1-tardbpb standard conditions Figure 2 with image from Campanari et al., 2021
thigmotaxis disrupted, abnormal WT + MO1-tardbpb standard conditions Fig. 5 from Kabashi et al., 2010
peripheral neuron branchiness, abnormal WT + MO1-tardbpb standard conditions Fig. 4,  Fig. 5 from Kabashi et al., 2010
neuromuscular junction development disrupted, abnormal WT + MO1-tardbpb standard conditions Figure 1 with image,  Figure 3 with image from Campanari et al., 2021
regulation of RNA splicing disrupted, abnormal WT + MO1-tardbpb standard conditions Fig. 6 from Demy et al., 2020
whole organism ache expression decreased amount, abnormal WT + MO1-tardbpb standard conditions Figure 2 with image from Campanari et al., 2021
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-tardbpb standard conditions Fig. 4 with image,  Fig. 5 from Chitramuthu et al., 2017
axon extension process quality, abnormal ml2Tg + MO1-tardbpb standard conditions Fig. 4 with image from Chitramuthu et al., 2017
thigmotaxis decreased process quality, abnormal ml2Tg + MO1-tardbpb standard conditions Fig. 5 from Chitramuthu et al., 2017
sensory perception of touch disrupted, abnormal WT + MO1-fus + MO1-tardbpb standard conditions Fig. 6 with image from Kabashi et al., 2011
motor neuron axon decreased length, abnormal WT + MO1-fus + MO1-tardbpb standard conditions Fig. 6 with image from Kabashi et al., 2011
sensory perception of touch disrupted, abnormal WT + MO1-sod1 + MO1-tardbpb standard conditions text only from Kabashi et al., 2011
motor neuron axon decreased length, abnormal WT + MO1-sod1 + MO1-tardbpb standard conditions text only from Kabashi et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.