Morpholino
MO1-crbn
- ID
- ZDB-MRPHLNO-100503-5
- Name
- MO1-crbn
- Previous Names
-
- zCrbn MO (1)
- Target
- Sequence
-
5' - AGAGCTGTAGCTGGTTCCCCATTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-crbn
Expressed Gene | Anatomy | Figures |
---|---|---|
ccnd1 |
Fig. S8
from Shen et al., 2021 |
|
fgf8a |
Fig. S14
from Ito et al., 2010 |
|
lef1 |
Fig. S8
from Shen et al., 2021 |
|
myca |
Fig. S8
from Shen et al., 2021 |
|
shha |
Fig. S14
from Ito et al., 2010 |
1 - 5 of 5
Phenotype
Phenotype resulting from MO1-crbn
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-crbn
1 - 5 of 10 Show all
Citations
- Shen, C., Nayak, A., Neitzel, L.R., Adams, A.A., Silver-Isenstadt, M., Sawyer, L.M., Benchabane, H., Wang, H., Bunnag, N., Li, B., Wynn, D.T., Yang, F., Garcia-Contreras, M., Williams, C.H., Dakshanamurthy, S., Hong, C.C., Ayad, N.G., Capobianco, A.J., Ahmed, Y., Lee, E., Robbins, D.J. (2021) The E3 ubiquitin ligase component, Cereblon, is an evolutionarily conserved regulator of Wnt signaling. Nature communications. 12:5263
- Ito, T., Ando, H., Suzuki, T., Ogura, T., Hotta, K., Imamura, Y., Yamaguchi, Y., and Handa, H. (2010) Identification of a primary target of thalidomide teratogenicity. Science (New York, N.Y.). 327(5971):1345-1350
1 - 2 of 2
Show