Morpholino
MO2-rbp4l
- ID
- ZDB-MRPHLNO-100503-17
- Name
- MO2-rbp4l
- Previous Names
-
- purpurin MO2 (1)
- Target
- Sequence
-
5' - TTAGATTCACAGCCTACCCGAAAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rbp4l
No data available
Phenotype
Phenotype resulting from MO2-rbp4l
| Phenotype | Fish | Figures |
|---|---|---|
| eye decreased size, abnormal | WT + MO2-rbp4l |
text only
from Nagashima et al., 2009 |
| retina layer formation disrupted, abnormal | WT + MO2-rbp4l |
text only
from Nagashima et al., 2009 |
Phenotype of all Fish created by or utilizing MO2-rbp4l
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| eye decreased size, abnormal | WT + MO2-rbp4l | standard conditions |
text only
from Nagashima et al., 2009 |
| retina layer formation disrupted, abnormal | WT + MO2-rbp4l | standard conditions |
text only
from Nagashima et al., 2009 |
Citations