Morpholino
MO2-nos1
- ID
- ZDB-MRPHLNO-100503-13
- Name
- MO2-nos1
- Previous Names
- None
- Target
- Sequence
-
5' - TTAATGACATCCCTCACCTCTCCAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nos1
No data available
Phenotype
Phenotype resulting from MO2-nos1
Phenotype | Fish | Figures |
---|---|---|
hematopoietic stem cell decreased amount, abnormal | WT + MO2-nos1 |
Fig. 5 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-nos1
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
hematopoietic stem cell decreased amount, abnormal | WT + MO2-nos1 | standard conditions |
Fig. 5 ![]() |
1 - 1 of 1
Citations
- Wittmann, C., Reischl, M., Shah, A.H., Kronfuss, E., Mikut, R., Liebel, U., Grabher, C. (2015) A Zebrafish Drug-Repurposing Screen Reveals sGC-Dependent and sGC-Independent Pro-Inflammatory Activities of Nitric Oxide. PLoS One. 10:e0137286
- Cox, A.G., Saunders, D.C., Kelsey, P.B., Conway, A.A., Tesmenitsky, Y., Marchini, J.F., Brown, K.K., Stamler, J.S., Colagiovanni, D.B., Rosenthal, G.J., Croce, K.J., North, T.E., and Goessling, W. (2014) S-Nitrosothiol Signaling Regulates Liver Development and Improves Outcome following Toxic Liver Injury. Cell Reports. 6(1):56-69
- Mugoni, V., Postel, R., Catanzaro, V., De Luca, E., Turco, E., Digilio, G., Silengo, L., Murphy, M.P., Medana, C., Stainier, D.Y., Bakkers, J., and Santoro, M.M. (2013) Ubiad1 Is an Antioxidant Enzyme that Regulates eNOS Activity by CoQ10 Synthesis. Cell. 152(3):504-518
- North, T.E., Goessling, W., Peeters, M., Li, P., Ceol, C., Lord, A.M., Weber, G.J., Harris, J., Cutting, C.C., Huang, P., Dzierzak, E., and Zon, L.I. (2009) Hematopoietic stem cell development is dependent on blood flow. Cell. 137(4):736-748
1 - 4 of 4
Show