Morpholino

MO1-prnpb

ID
ZDB-MRPHLNO-100423-4
Name
MO1-prnpb
Previous Names
  • prp1-1 MO (1)
Target
Sequence
5' - TCTCTCCCGCAGCACTCTCTGCTCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prnpb
Expressed Gene Anatomy Figures
cdh1 Fig. 6 with image from Málaga-Trillo et al., 2009
prnpb Fig. 2 with image from Málaga-Trillo et al., 2009
Phenotype
Phenotype resulting from MO1-prnpb
Phenotype Fish Figures
adherens junction maintenance disrupted, abnormal WT + MO1-prnpb Fig. 8 with image from Málaga-Trillo et al., 2009
calcium-independent cell-cell adhesion via plasma membrane cell-adhesion molecules disrupted, abnormal WT + MO1-prnpb Fig. 5 with image from Málaga-Trillo et al., 2009
cell death increased occurrence, abnormal AB + MO1-prnpb Fig. 1 with image from Kaiser et al., 2012
cell-cell adhesion disrupted, abnormal WT + MO1-prnpb Fig. 4 with image from Málaga-Trillo et al., 2009
central nervous system morphology, abnormal AB + MO1-prnpb Fig. 1 with image from Kaiser et al., 2012
central nervous system development disrupted, abnormal AB + MO1-prnpb Fig. 1 with image from Kaiser et al., 2012
cranium edematous, abnormal AB + MO1-prnpb Fig. 1 with image from Kaiser et al., 2012
DEL increased accumulation DEL cytoplasmic vesicle, abnormal WT + MO1-prnpb Fig. 6 with image from Málaga-Trillo et al., 2009
DEL adherens junction disorganized, abnormal WT + MO1-prnpb Fig. 6 with image from Málaga-Trillo et al., 2009
DEL cell circular, abnormal WT + MO1-prnpb Fig. 4 with image from Málaga-Trillo et al., 2009
DEL cell disorganized, abnormal WT + MO1-prnpb Fig. 4 with image from Málaga-Trillo et al., 2009
EVL adherens junction disorganized, abnormal WT + MO1-prnpb Fig. 8 with image from Málaga-Trillo et al., 2009
gastrulation arrested, abnormal WT + MO1-prnpb Fig. 2 with image from Málaga-Trillo et al., 2009
mediolateral intercalation disrupted, abnormal WT + MO1-prnpb Fig. 7 with image from Málaga-Trillo et al., 2009
whole organism decreased size, abnormal AB + MO1-prnpb Fig. 1 with image from Kaiser et al., 2012
whole organism morphology, abnormal AB + MO1-prnpb Figure 4. with image from Pollock et al., 2021
whole organism necrotic, abnormal AB + MO1-prnpb Figure 4. with image from Pollock et al., 2021
Phenotype of all Fish created by or utilizing MO1-prnpb
Phenotype Fish Conditions Figures
cell death increased occurrence, abnormal AB + MO1-prnpb standard conditions Fig. 1 with image from Kaiser et al., 2012
whole organism necrotic, abnormal AB + MO1-prnpb standard conditions Figure 4. with image from Pollock et al., 2021
whole organism morphology, abnormal AB + MO1-prnpb standard conditions Figure 4. with image from Pollock et al., 2021
central nervous system development disrupted, abnormal AB + MO1-prnpb standard conditions Fig. 1 with image from Kaiser et al., 2012
cranium edematous, abnormal AB + MO1-prnpb standard conditions Fig. 1 with image from Kaiser et al., 2012
central nervous system morphology, abnormal AB + MO1-prnpb standard conditions Fig. 1 with image from Kaiser et al., 2012
whole organism decreased size, abnormal AB + MO1-prnpb standard conditions Fig. 1 with image from Kaiser et al., 2012
DEL increased accumulation DEL cytoplasmic vesicle, abnormal WT + MO1-prnpb standard conditions Fig. 6 with image from Málaga-Trillo et al., 2009
EVL adherens junction disorganized, abnormal WT + MO1-prnpb standard conditions Fig. 8 with image from Málaga-Trillo et al., 2009
DEL cell circular, abnormal WT + MO1-prnpb standard conditions Fig. 4 with image from Málaga-Trillo et al., 2009
mediolateral intercalation disrupted, abnormal WT + MO1-prnpb standard conditions Fig. 7 with image from Málaga-Trillo et al., 2009
adherens junction maintenance disrupted, abnormal WT + MO1-prnpb standard conditions Fig. 8 with image from Málaga-Trillo et al., 2009
cell-cell adhesion disrupted, abnormal WT + MO1-prnpb standard conditions Fig. 4 with image from Málaga-Trillo et al., 2009
calcium-independent cell-cell adhesion via plasma membrane cell-adhesion molecules disrupted, abnormal WT + MO1-prnpb standard conditions Fig. 5 with image from Málaga-Trillo et al., 2009
DEL adherens junction disorganized, abnormal WT + MO1-prnpb standard conditions Fig. 6 with image from Málaga-Trillo et al., 2009
DEL cell disorganized, abnormal WT + MO1-prnpb standard conditions Fig. 4 with image from Málaga-Trillo et al., 2009
gastrulation arrested, abnormal WT + MO1-prnpb standard conditions Fig. 2 with image from Málaga-Trillo et al., 2009
whole organism ab2-ctnnb labeling amount, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 1 with image,  Fig. 4 with image from Sempou et al., 2016
DEL intracellular anatomical structure ab2-ctnnb labeling mislocalised, abnormal WT + MO1-prnpb + MO2-prnpb control Fig. 1 with image,  Fig. 3 with image from Sempou et al., 2016
epiboly arrested, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: dynasore Fig. 1 with image from Sempou et al., 2016
epiboly arrested, abnormal WT + MO1-prnpb + MO2-prnpb standard conditions Fig. 1 with image,  Fig. 2 with image from Sempou et al., 2016
blastoderm thickness, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: ammonium chloride Fig. 1 with image from Sempou et al., 2016
whole organism ab2-ctnnb labeling amount, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: chloroquine Fig. 1 with image,  Fig. 4 with image from Sempou et al., 2016
epiboly arrested, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: ammonium chloride Fig. 1 with image from Sempou et al., 2016
endocytosis increased occurrence, abnormal WT + MO1-prnpb + MO2-prnpb control Fig. 1 with image from Sempou et al., 2016
whole organism ab2-ctnnb labeling decreased amount, abnormal WT + MO1-prnpb + MO2-prnpb control Fig. 1 with image,  Fig. 4 with image from Sempou et al., 2016
epiboly arrested, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: chloroquine Fig. 1 with image from Sempou et al., 2016
DEL cytosol ab2-ctnnb labeling mislocalised, abnormal WT + MO1-prnpb + MO2-prnpb control Fig. 1 with image,  Fig. 3 with image from Sempou et al., 2016
blastoderm thickness, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 1 with image from Sempou et al., 2016
blastoderm thickness, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: chloroquine Fig. 1 with image from Sempou et al., 2016
DEL cell surface ab2-ctnnb labeling position, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: dynasore Fig. 1 with image from Sempou et al., 2016
blastoderm thickness, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: dynasore Fig. 1 with image from Sempou et al., 2016
blastoderm increased thickness, abnormal WT + MO1-prnpb + MO2-prnpb control Fig. 1 with image from Sempou et al., 2016
epiboly arrested, ameliorated WT + MO1-prnpb + MO2-prnpb chemical treatment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 1 with image from Sempou et al., 2016
cell death increased occurrence, abnormal AB + MO1-prnpb + MO2-appa standard conditions Fig. 3 with image from Kaiser et al., 2012
central nervous system malformed, abnormal AB + MO1-prnpb + MO2-appa standard conditions Fig. 3 with image from Kaiser et al., 2012
peripheral nervous system malformed, abnormal AB + MO1-prnpb + MO2-appa standard conditions Fig. 3 with image from Kaiser et al., 2012
activation of cysteine-type endopeptidase activity involved in apoptotic process increased occurrence, abnormal AB + MO1-prnpb + MO2-appa standard conditions Fig. 4 with image from Kaiser et al., 2012
whole organism cell decreased adhesivity, abnormal AB + MO1-prnpb + MO2-appa standard conditions Fig. 5 with image from Kaiser et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.