Morpholino
MO1-adrb2a
- ID
- ZDB-MRPHLNO-100416-5
- Name
- MO1-adrb2a
- Previous Names
- None
- Target
- Sequence
-
5' - GTATTGAGGACCTTATGTTTCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adrb2a
Expressed Gene | Anatomy | Figures |
---|---|---|
atp5f1b |
Fig. 5
from Wang et al., 2009 |
|
atp5fa1 |
text only
from Wang et al., 2009 |
|
atp7a |
text only
from Wang et al., 2009 |
|
dct |
text only
from Wang et al., 2009 |
|
ddc |
text only
from Wang et al., 2009 |
|
kitlga |
text only
from Wang et al., 2009 |
|
mitfa |
text only
from Wang et al., 2009 |
|
prkcbb |
text only
from Wang et al., 2009 |
|
rack1 |
text only
from Wang et al., 2009 |
|
slc24a5 |
text only
from Wang et al., 2009 |
|
tgfb1a |
text only
from Wang et al., 2009 |
|
tnfa |
text only
from Wang et al., 2009 |
|
tyr |
Fig. 5
from Wang et al., 2009 |
|
tyrp1b |
text only
from Wang et al., 2009 |
Phenotype
Phenotype resulting from MO1-adrb2a
Phenotype of all Fish created by or utilizing MO1-adrb2a
Citations