Morpholino
MO1-adrb2a
- ID
- ZDB-MRPHLNO-100416-5
- Name
- MO1-adrb2a
- Previous Names
- None
- Target
- Sequence
-
5' - GTATTGAGGACCTTATGTTTCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adrb2a
Expressed Gene | Anatomy | Figures |
---|---|---|
atp5f1b |
Fig. 5 ![]() |
|
atp5fa1 |
text only
from Wang et al., 2009 |
|
atp7a |
text only
from Wang et al., 2009 |
|
dct |
text only
from Wang et al., 2009 |
|
ddc |
text only
from Wang et al., 2009 |
|
kitlga |
text only
from Wang et al., 2009 |
|
mitfa |
text only
from Wang et al., 2009 |
|
prkcbb |
text only
from Wang et al., 2009 |
|
rack1 |
text only
from Wang et al., 2009 |
|
slc24a5 |
text only
from Wang et al., 2009 |
|
tgfb1a |
text only
from Wang et al., 2009 |
|
tnfa |
text only
from Wang et al., 2009 |
|
tyr |
Fig. 5 ![]() |
|
tyrp1b |
text only
from Wang et al., 2009 |
Phenotype
Phenotype resulting from MO1-adrb2a
Phenotype of all Fish created by or utilizing MO1-adrb2a
Citations
- Li, W., Shenkar, R., Detter, M.R., Moore, T., Benavides, C.R., Lightle, R., Girard, R., Hobson, N., Cao, Y., Li, Y., Griffin, E., Gallione, C., Zabramski, J.M., Ginsberg, M.H., Marchuk, D.A., Awad, I.A. (2020) Propranolol inhibits cavernous vascular malformations by β1 adrenergic receptor antagonism. The Journal of Clinical Investigation. 131(3)
- Kumai, Y., Ward, M., and Perry, S.F. (2012) β-Adrenergic regulation of Na+ uptake by larval zebrafish Danio rerio in acidic and ion-poor environments. American journal of physiology. Regulatory, integrative and comparative physiology. 303(10):R1031-1041
- Steele, S.L., Yang, X., Debiais-Thibaud, M., Schwerte, T., Pelster, B., Ekker, M., Tiberi, M., Perry, S.F. (2011) In vivo and in vitro assessment of cardiac {beta}-adrenergic receptors in larval zebrafish (Danio rerio). The Journal of experimental biology. 214(9):1445-1457
- Wang, Z., Nishimura, Y., Shimada, Y., Umemoto, N., Hirano, M., Zang, L., Oka, T., Sakamoto, C., Kuroyanagi, J., and Tanaka, T. (2009) Zebrafish beta-adrenergic receptor mRNA expression and control of pigmentation. Gene. 446(1):18-27
1 - 4 of 4
Show