ZFIN ID: ZDB-MRPHLNO-100416-10
Morpholino Name: MO1-adrb2b
Target: adrb2b (1)
Sequence:
5' - TCAGCGTATTCTCTCCCTCCATGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-adrb2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-adrb2b No data available
PHENOTYPE
Phenotype resulting from MO1-adrb2b
Phenotype Figures
head decreased size, abnormal Fig. S4 with image from Wang et al., 2009
trunk shape, abnormal Fig. S4 with image from Wang et al., 2009
whole organism edematous, abnormal Fig. S4 with image from Wang et al., 2009
whole organism swollen, abnormal Fig. S4 with image from Wang et al., 2009

Phenotype of all Fish created by or utilizing MO1-adrb2b
Phenotype Fish Conditions Figures
trunk shape, abnormal WT + MO1-adrb2b standard conditions Fig. S4 with image from Wang et al., 2009
head decreased size, abnormal WT + MO1-adrb2b standard conditions Fig. S4 with image from Wang et al., 2009
whole organism swollen, abnormal WT + MO1-adrb2b standard conditions Fig. S4 with image from Wang et al., 2009
whole organism edematous, abnormal WT + MO1-adrb2b standard conditions Fig. S4 with image from Wang et al., 2009
OTHER MO1-adrb2b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)