Morpholino

MO1-sumo3a

ID
ZDB-MRPHLNO-100415-9
Name
MO1-sumo3a
Previous Names
  • MO1-sumo3l
  • SUMO3 MO (1)
Target
Sequence
5' - TAGGCTTGTCTTCGGACATTTTTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sumo3a
No data available
Phenotype
Phenotype resulting from MO1-sumo3a
No data available
Phenotype of all Fish created by or utilizing MO1-sumo3a
Phenotype Fish Conditions Figures
pharyngeal arch 3 decreased size, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
eye decreased size, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
retinal inner plexiform layer cell decreased amount, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
erythroid lineage cell decreased amount, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 with imageFig. 5 with image from Yuan et al., 2015
pharyngeal arch 6 decreased size, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
thymus lymphoid progenitor cell aplastic, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 with image from Yuan et al., 2015
myeloid cell decreased amount, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 with imageFig. 5 with image from Yuan et al., 2015
pharyngeal arch 3-7 chondrocyte increased size, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
thymus lymphoid progenitor cell absent, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 with imageFig. 5 with image from Yuan et al., 2015
brain decreased size, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
pharyngeal arch 5 decreased size, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
mandibular arch skeleton malformed, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 1 with imageFig. 4 with imageFig. 5 with image from Yuan et al., 2015
pharyngeal arch 4 decreased size, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
retinal ganglion cell layer cell decreased amount, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
retinal outer nuclear layer cell decreased amount, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
apoptotic process increased occurrence, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2Fig. 3 from Yuan et al., 2010
retinal inner nuclear layer cell decreased amount, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 2 from Yuan et al., 2010
apoptotic process decreased occurrence, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a + MO7-tp53 standard conditions Fig. 4 from Yuan et al., 2010
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a + MO7-tp53 standard conditions Fig. 1 with image from Yuan et al., 2015
apoptotic process increased occurrence, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a + MO8-tp53 standard conditions Fig. 4 from Yuan et al., 2010
hematopoietic multipotent progenitor cell decreased amount, abnormal cebparj31/+ + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 4 with image from Yuan et al., 2015
definitive hemopoiesis decreased process quality, abnormal s843Tg + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 3 with image from Yuan et al., 2015
hematopoietic multipotent progenitor cell cell population proliferation decreased process quality, abnormal zf169Tg + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 3 with image from Yuan et al., 2015
hematopoietic multipotent progenitor cell decreased amount, abnormal zf169Tg + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a standard conditions Fig. 4 with image from Yuan et al., 2015
Citations