Morpholino
MO2-hif1ab
- ID
- ZDB-MRPHLNO-100414-7
- Name
- MO2-hif1ab
- Previous Names
-
- hif1a-MO (1)
- Target
- Sequence
-
5' - CAGTGACAACTCCAGTATCCATTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-hif1ab
No data available
Phenotype
Phenotype resulting from MO2-hif1ab
No data available
Phenotype of all Fish created by or utilizing MO2-hif1ab
1 - 3 of 3
Citations
- Tan, T., Yu, R.M.K., Wu, R.S.S., Kong, R.Y.C. (2017) Overexpression and Knockdown of Hypoxia-Inducible Factor 1 Disrupt the Expression of Steroidogenic Enzyme Genes and Early Embryonic Development in Zebrafish. Gene regulation and systems biology. 11:1177625017713193
- Martins Metelo, A., Noonan, H.R., Xiang, L., Jin, Y., Baker, R., Kamentsky, L., Zhang, Y., van Rooijen, E., Shin, J., Carpenter, A.E., Yeh, J.R., Peterson, R.T., Iliopoulos, O. (2015) Pharmacological HIF2α inhibition improves VHL disease–associated phenotypes in zebrafish model. J. Clin. Invest.. 125(5):1987-97
- Lin, T.Y., Chou, C.F., Chung, H.Y., Chiang, C.Y., Li, C.H., Wu, J.L., Lin, H.J., Pai, T.W., Hu, C.H., Tzou, W.S. (2014) Hypoxia-Inducible Factor 2 Alpha Is Essential for Hepatic Outgrowth and Functions via the Regulation of leg1 Transcription in the Zebrafish Embryo. PLoS One. 9:e101980
- Ko, C.Y., Tsai, M.Y., Tseng, W.F., Cheng, C.H., Huang, C.R., Wu, J.S., Chung, H.Y., Hsieh, C.S., Sun, C.K., Hwang, S.P., Yuh, C.H., Huang, C.J., Pai, T.W., Tzou, W.S., and Hu, C.H. (2011) Integration of CNS survival and differentiation by HIF2α. Cell death and differentiation. 18(11):1757-70
- Hsieh, C.S., Ko, C.Y., Chen, S.Y., Liu, T.M., Wu, J.S., Hu, C.H., and Sun, C.K. (2008) In vivo long-term continuous observation of gene expression in zebrafish embryo nerve systems by using harmonic generation microscopy and morphant technology. Journal of Biomedical Optics. 13(6):064041
1 - 5 of 5
Show