Morpholino

MO1-mtm1

ID
ZDB-MRPHLNO-100325-1
Name
MO1-mtm1
Previous Names
  • ATG MO (1)
Target
Sequence
5' - AGACCCTCGTCGAAAAGTCATAACG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mtm1
No data available
Phenotype
Phenotype resulting from MO1-mtm1
Phenotype Fish Figures
ball deformed, abnormal WT + MO1-mtm1 Fig. 1 with image from Dowling et al., 2009
extension decreased size, abnormal WT + MO1-mtm1 Fig. 1 with image from Dowling et al., 2009
hatching disrupted, abnormal WT + MO1-mtm1 Fig. 2 with image from Dowling et al., 2009
head decreased size, abnormal WT + MO1-mtm1 Fig. 1 with image from Dowling et al., 2009
locomotory behavior decreased occurrence, abnormal WT + MO1-mtm1 text only from Robb et al., 2011
musculoskeletal movement, spinal reflex action disrupted, abnormal WT + MO1-mtm1 Fig. 2 with image from Dowling et al., 2009
neuromuscular junction development disrupted, abnormal WT + MO1-mtm1 Fig. 4 from Robb et al., 2011
phosphatidylinositol dephosphorylation disrupted, abnormal WT + MO1-mtm1 Fig. 6 with image from Dowling et al., 2009
post-vent region bent, abnormal WT + MO1-mtm1 Fig. 1 with image from Dowling et al., 2009
post-vent region decreased length, abnormal WT + MO1-mtm1 Fig. 1 with image from Dowling et al., 2009
skeletal muscle cell decreased functionality, abnormal WT + MO1-mtm1 Fig. 10 with image from Dowling et al., 2009
skeletal muscle cell hypotrophic, abnormal WT + MO1-mtm1 Fig. 5 with image from Dowling et al., 2009
skeletal muscle cell separated from skeletal muscle cell, abnormal WT + MO1-mtm1 Fig. 3 with image from Dowling et al., 2009
skeletal muscle cell mitochondrion morphology, abnormal WT + MO1-mtm1 Fig. 4 with image from Dowling et al., 2009
skeletal muscle cell nucleus increased size, abnormal WT + MO1-mtm1 Fig. 3 with image,  Fig. 4 with image from Dowling et al., 2009
skeletal muscle cell nucleus mislocalised, abnormal WT + MO1-mtm1 Fig. 3 with image from Dowling et al., 2009
skeletal muscle cell nucleus shape, abnormal WT + MO1-mtm1 Fig. 3 with image,  Fig. 4 with image from Dowling et al., 2009
skeletal muscle cell perinuclear region of cytoplasm disorganized, abnormal WT + MO1-mtm1 Fig. 4 with image from Dowling et al., 2009
skeletal muscle cell sarcoplasmic reticulum disorganized, abnormal WT + MO1-mtm1 Fig. 9 with image from Dowling et al., 2009
skeletal muscle cell T-tubule disorganized, abnormal WT + MO1-mtm1 Fig. 9 with image from Dowling et al., 2009
thigmotaxis disrupted, abnormal WT + MO1-mtm1 Fig. 2 with image from Dowling et al., 2009
trunk curved dorsal, abnormal WT + MO1-mtm1 Fig. 1 with image from Dowling et al., 2009
trunk musculature decreased size, abnormal WT + MO1-mtm1 Fig. 1 with image from Dowling et al., 2009
whole organism malformed, abnormal WT + MO1-mtm1 Fig. 1 with image from Dowling et al., 2009
Phenotype of all Fish created by or utilizing MO1-mtm1
Phenotype Fish Conditions Figures
trunk musculature decreased size, abnormal WT + MO1-mtm1 standard conditions Fig. 1 with image from Dowling et al., 2009
trunk curved dorsal, abnormal WT + MO1-mtm1 standard conditions Fig. 1 with image from Dowling et al., 2009
thigmotaxis disrupted, abnormal WT + MO1-mtm1 standard conditions Fig. 2 with image from Dowling et al., 2009
head decreased size, abnormal WT + MO1-mtm1 standard conditions Fig. 1 with image from Dowling et al., 2009
extension decreased size, abnormal WT + MO1-mtm1 standard conditions Fig. 1 with image from Dowling et al., 2009
skeletal muscle cell decreased functionality, abnormal WT + MO1-mtm1 standard conditions Fig. 10 with image from Dowling et al., 2009
skeletal muscle cell T-tubule disorganized, abnormal WT + MO1-mtm1 standard conditions Fig. 9 with image from Dowling et al., 2009
skeletal muscle cell nucleus mislocalised, abnormal WT + MO1-mtm1 standard conditions Fig. 3 with image from Dowling et al., 2009
skeletal muscle cell mitochondrion morphology, abnormal WT + MO1-mtm1 standard conditions Fig. 4 with image from Dowling et al., 2009
ball deformed, abnormal WT + MO1-mtm1 standard conditions Fig. 1 with image from Dowling et al., 2009
skeletal muscle cell separated from skeletal muscle cell, abnormal WT + MO1-mtm1 standard conditions Fig. 3 with image from Dowling et al., 2009
phosphatidylinositol dephosphorylation disrupted, abnormal WT + MO1-mtm1 standard conditions Fig. 6 with image from Dowling et al., 2009
post-vent region decreased length, abnormal WT + MO1-mtm1 standard conditions Fig. 1 with image from Dowling et al., 2009
locomotory behavior decreased occurrence, abnormal WT + MO1-mtm1 standard conditions text only from Robb et al., 2011
skeletal muscle cell perinuclear region of cytoplasm disorganized, abnormal WT + MO1-mtm1 standard conditions Fig. 4 with image from Dowling et al., 2009
skeletal muscle cell sarcoplasmic reticulum disorganized, abnormal WT + MO1-mtm1 standard conditions Fig. 9 with image from Dowling et al., 2009
whole organism malformed, abnormal WT + MO1-mtm1 standard conditions Fig. 1 with image from Dowling et al., 2009
post-vent region bent, abnormal WT + MO1-mtm1 standard conditions Fig. 1 with image from Dowling et al., 2009
skeletal muscle cell hypotrophic, abnormal WT + MO1-mtm1 standard conditions Fig. 5 with image from Dowling et al., 2009
neuromuscular junction development disrupted, abnormal WT + MO1-mtm1 standard conditions Fig. 4 from Robb et al., 2011
hatching disrupted, abnormal WT + MO1-mtm1 standard conditions Fig. 2 with image from Dowling et al., 2009
musculoskeletal movement, spinal reflex action disrupted, abnormal WT + MO1-mtm1 standard conditions Fig. 2 with image from Dowling et al., 2009
skeletal muscle cell nucleus shape, abnormal WT + MO1-mtm1 standard conditions Fig. 3 with image,  Fig. 4 with image from Dowling et al., 2009
skeletal muscle cell nucleus increased size, abnormal WT + MO1-mtm1 standard conditions Fig. 3 with image,  Fig. 4 with image from Dowling et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.