Morpholino

MO1-gdf3

ID

ZDB-MRPHLNO-100312-1

Name

MO1-gdf3

Previous Names

None

Target

Sequence

5' - AGGCTCTGAGGAGGACTAAGAACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gdf3

Expressed Gene	Anatomy	Figures
aldh1a2	immature eye	Fig. 6 from Ye et al., 2010
efna5a	immature eye	Fig. 6 from Ye et al., 2010
epha4b	immature eye	Fig. 6 from Ye et al., 2010
foxg1a	immature eye solid lens vesicle	Fig. 6 from Ye et al., 2010
gje1a	solid lens vesicle	Fig. 6 from Ye et al., 2010
lim2.3	solid lens vesicle	Fig. 6 from Ye et al., 2010
tbx5a	immature eye	Fig. 6 from Ye et al., 2010
vax2	immature eye	Fig. 6 from Ye et al., 2010

Phenotype

Phenotype resulting from MO1-gdf3

Phenotype	Fish	Figures
eye decreased size, abnormal	AB + MO1-gdf3	Fig. 4, Fig. 5 from Ye et al., 2010
eye perforate, abnormal	AB + MO1-gdf3	Fig. 4 from Ye et al., 2010
lens decreased size, abnormal	AB + MO1-gdf3	Fig. 4 from Ye et al., 2010
optic fissure closure incomplete, abnormal	AB + MO1-gdf3	Fig. 4 from Ye et al., 2010
post-vent region curved ventral, abnormal	AB + MO1-gdf3	Fig. 4 from Ye et al., 2010
post-vent region decreased length, abnormal	AB + MO1-gdf3	Fig. 4 from Ye et al., 2010
retina decreased size, abnormal	AB + MO1-gdf3	Fig. 4 from Ye et al., 2010
retina photoreceptor outer segment absent, abnormal	AB + MO1-gdf3	Fig. 5 from Ye et al., 2010
retina photoreceptor outer segment decreased length, abnormal	AB + MO1-gdf3	Fig. 5 from Ye et al., 2010
skeletal system morphology, abnormal	AB + MO1-gdf3	Fig. 4 from Ye et al., 2010

Phenotype of all Fish created by or utilizing MO1-gdf3

Phenotype	Fish	Conditions	Figures
retina decreased size, abnormal	AB + MO1-gdf3	standard conditions	Fig. 4 from Ye et al., 2010
retina photoreceptor outer segment decreased length, abnormal	AB + MO1-gdf3	standard conditions	Fig. 5 from Ye et al., 2010
post-vent region decreased length, abnormal	AB + MO1-gdf3	standard conditions	Fig. 4 from Ye et al., 2010
optic fissure closure incomplete, abnormal	AB + MO1-gdf3	standard conditions	Fig. 4 from Ye et al., 2010
eye decreased size, abnormal	AB + MO1-gdf3	standard conditions	Fig. 4, Fig. 5 from Ye et al., 2010
retina photoreceptor outer segment absent, abnormal	AB + MO1-gdf3	standard conditions	Fig. 5 from Ye et al., 2010
skeletal system morphology, abnormal	AB + MO1-gdf3	standard conditions	Fig. 4 from Ye et al., 2010
post-vent region curved ventral, abnormal	AB + MO1-gdf3	standard conditions	Fig. 4 from Ye et al., 2010
lens decreased size, abnormal	AB + MO1-gdf3	standard conditions	Fig. 4 from Ye et al., 2010
eye perforate, abnormal	AB + MO1-gdf3	standard conditions	Fig. 4 from Ye et al., 2010

Citations