ZFIN ID: ZDB-MRPHLNO-100308-2
Morpholino Name: MO2-lrp5
Target: lrp5 (1)
Previous Name: zLRP6 MO2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCTCTATTCTTGGCTCCTCCCCCCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-lrp5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-lrp5
Expressed Gene Anatomy Figures
ctnnb1 Fig. 4 from Chen et al., 2009
PHENOTYPE
Phenotype resulting from MO2-lrp5
No data available

Phenotype of all Fish created by or utilizing MO2-lrp5
No data available
Genome Resources:
CITATIONS (1)