header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100308-1
Morpholino Name: MO1-lrp5
Target: lrp5 (1)
Previous Name: zLRP6 MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GATTGCTGCCATCCATTCCGGCCCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lrp5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lrp5
Expressed Gene Anatomy Figures
axin2 Fig. 4 from Chen et al., 2009
cp Fig. 7 with image from Lu et al., 2013
hhex Fig. 7 with image from Lu et al., 2013
lrp5 Fig. 4 from Chen et al., 2009
PHENOTYPE
Phenotype resulting from MO1-lrp5
Phenotype of all Fish created by or utilizing MO1-lrp5
Genome Resources:
CITATIONS (2)