Morpholino

MO1-dync2i2

ID

ZDB-MRPHLNO-100217-25

Name

MO1-dync2i2

Previous Names

dync2-i1MO1 (1)
MO1-wdr34

Target

dync2i2 (1)

Sequence

5' - ACAATAAACTGTTACCGGCCAAATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dync2i2

Expressed Gene	Anatomy	Figures
ift88	retinal photoreceptor layer photoreceptor connecting cilium	Fig. 6 from Krock et al., 2009

Phenotype

Phenotype resulting from MO1-dync2i2

Phenotype	Fish	Figures
eye decreased size, abnormal	WT + MO1-dync2i2	Fig. 2, Fig. 3 from Krock et al., 2009
intraciliary transport disrupted, abnormal	WT + MO1-dync2i2	Fig. 6 from Krock et al., 2009
neural tube curved ventral, abnormal	AB + MO1-dync2i2	Fig. 3 from Yin et al., 2020
olfactory epithelium axoneme swollen, abnormal	WT + MO1-dync2i2	Fig. 5 from Krock et al., 2009
olfactory epithelium non-motile cilium decreased length, abnormal	WT + MO1-dync2i2	Fig. 5 from Krock et al., 2009
pericardial region morphology, abnormal	AB + MO1-dync2i2	Fig. 3 from Yin et al., 2020
photoreceptor cell intraciliary transport particle mislocalised, abnormal	WT + MO1-dync2i2	Fig. 6 from Krock et al., 2009
photoreceptor cell photoreceptor connecting cilium swollen, abnormal	WT + MO1-dync2i2	Fig. 4 from Krock et al., 2009
photoreceptor cell photoreceptor outer segment decreased length, abnormal	WT + MO1-dync2i2	Fig. 4, Fig. 6 from Krock et al., 2009
pronephric duct motile cilium decreased amount, abnormal	WT + MO1-dync2i2	Fig. 5 from Krock et al., 2009
pronephros cystic, abnormal	WT + MO1-dync2i2	Fig. 2, Fig. 5 from Krock et al., 2009
vertebral column decreased length, abnormal	AB + MO1-dync2i2	Fig. 3 from Yin et al., 2020
whole organism curved ventral, abnormal	WT + MO1-dync2i2	Fig. 2 from Krock et al., 2009
whole organism decreased length, abnormal	WT + MO1-dync2i2	Fig. 2 from Krock et al., 2009

Phenotype of all Fish created by or utilizing MO1-dync2i2

Phenotype	Fish	Conditions	Figures
vertebral column decreased length, abnormal	AB + MO1-dync2i2	standard conditions	Fig. 3 from Yin et al., 2020
pericardial region morphology, abnormal	AB + MO1-dync2i2	standard conditions	Fig. 3 from Yin et al., 2020
neural tube curved ventral, abnormal	AB + MO1-dync2i2	standard conditions	Fig. 3 from Yin et al., 2020
photoreceptor cell intraciliary transport particle mislocalised, abnormal	WT + MO1-dync2i2	standard conditions	Fig. 6 from Krock et al., 2009
pronephric duct motile cilium decreased amount, abnormal	WT + MO1-dync2i2	standard conditions	Fig. 5 from Krock et al., 2009
photoreceptor cell photoreceptor connecting cilium swollen, abnormal	WT + MO1-dync2i2	standard conditions	Fig. 4 from Krock et al., 2009
whole organism decreased length, abnormal	WT + MO1-dync2i2	standard conditions	Fig. 2 from Krock et al., 2009
intraciliary transport disrupted, abnormal	WT + MO1-dync2i2	standard conditions	Fig. 6 from Krock et al., 2009
photoreceptor cell photoreceptor outer segment decreased length, abnormal	WT + MO1-dync2i2	standard conditions	Fig. 4, Fig. 6 from Krock et al., 2009
olfactory epithelium axoneme swollen, abnormal	WT + MO1-dync2i2	standard conditions	Fig. 5 from Krock et al., 2009
olfactory epithelium non-motile cilium decreased length, abnormal	WT + MO1-dync2i2	standard conditions	Fig. 5 from Krock et al., 2009
whole organism curved ventral, abnormal	WT + MO1-dync2i2	standard conditions	Fig. 2 from Krock et al., 2009
eye decreased size, abnormal	WT + MO1-dync2i2	standard conditions	Fig. 2, Fig. 3 from Krock et al., 2009
pronephros cystic, abnormal	WT + MO1-dync2i2	standard conditions	Fig. 2, Fig. 5 from Krock et al., 2009

Citations