Morpholino

MO1-usp18

ID
ZDB-MRPHLNO-100217-11
Name
MO1-usp18
Previous Names
None
Target
Sequence
5' - CCATTTTACTCCAGTAGTCCCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-usp18
No data available
Phenotype
Phenotype resulting from MO1-usp18
Phenotype Fish Figures
central nervous system necrotic, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
ethmoid cartilage shape, abnormal AB + MO1-usp18 Fig. 3 from Tse, 2017
eye decreased size, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
head decreased size, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
mandibular arch skeleton decreased size, abnormal AB + MO1-usp18 Fig. 3 from Tse, 2017
Meckel's cartilage morphology, abnormal AB + MO1-usp18 Fig. 3 from Tse, 2017
notochord decreased length, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
pericardium edematous, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
pharyngeal arch cartilage malformed, abnormal AB + MO1-usp18 Fig. 3 from Tse, 2017
post-vent region curled, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
post-vent region necrotic, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
somite fused with somite, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
trunk decreased thickness, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
trunk immature, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
yolk deformed, abnormal WT + MO1-usp18 Fig. S4 from Tse et al., 2009
Phenotype of all Fish created by or utilizing MO1-usp18
Phenotype Fish Conditions Figures
pharyngeal arch cartilage malformed, abnormal AB + MO1-usp18 standard conditions Fig. 3 from Tse, 2017
ethmoid cartilage shape, abnormal AB + MO1-usp18 standard conditions Fig. 3 from Tse, 2017
Meckel's cartilage morphology, abnormal AB + MO1-usp18 standard conditions Fig. 3 from Tse, 2017
mandibular arch skeleton decreased size, abnormal AB + MO1-usp18 standard conditions Fig. 3 from Tse, 2017
eye decreased size, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
trunk immature, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
yolk deformed, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
central nervous system necrotic, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
pericardium edematous, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
whole organism decreased size, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
somite fused with somite, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
post-vent region curled, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
post-vent region necrotic, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
trunk decreased thickness, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
head decreased size, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
notochord decreased length, abnormal WT + MO1-usp18 standard conditions Fig. S4 from Tse et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.