header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100105-2
Morpholino Name: MO2-fxr1
Target: fxr1 (1)
Sequence:
5' - GATGCTGGGTAAAGTTCCAGAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-fxr1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-fxr1
Expressed Gene Anatomy Figures
dmd Fig. 4 from van't Padje et al., 2009
fxr1 Fig. 1 from van't Padje et al., 2009
myod1 Fig. 3 from van't Padje et al., 2009
PHENOTYPE
Phenotype resulting from MO2-fxr1
Phenotype of all Fish created by or utilizing MO2-fxr1
OTHER MO2-fxr1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)