Morpholino

MO1-fxr1

ID

ZDB-MRPHLNO-100105-1

Name

MO1-fxr1

Previous Names

None

Target

fxr1 (1)

Sequence

5' - GTCAGTTCCTCCATGTTGAGCGCGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fxr1

Expressed Gene	Anatomy	Figures
myl7	heart	Fig. 5 from van't Padje et al., 2009

Phenotype

Phenotype resulting from MO1-fxr1

Phenotype	Fish	Figures
atrium tubular, abnormal	WT + MO1-fxr1	Fig. 5 from van't Padje et al., 2009
cardiac ventricle tubular, abnormal	WT + MO1-fxr1	Fig. 5 from van't Padje et al., 2009
heart decreased functionality, abnormal	WT + MO1-fxr1	Fig. 5 from van't Padje et al., 2009
heart linear, abnormal	WT + MO1-fxr1	Fig. 5 from van't Padje et al., 2009
heart contraction decreased rate, abnormal	WT + MO1-fxr1	text only from van't Padje et al., 2009
heart looping disrupted, abnormal	WT + MO1-fxr1	Fig. 5 from van't Padje et al., 2009
horizontal myoseptum aplastic, abnormal	WT + MO1-fxr1	Fig. 3 from van't Padje et al., 2009
myotome myofibril irregular spatial pattern, abnormal	WT + MO1-fxr1	Fig. 3 from van't Padje et al., 2009
pericardium edematous, abnormal	WT + MO1-fxr1	Fig. 2, Fig. 3 from van't Padje et al., 2009
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-fxr1	Fig. 2, Fig. 3 from van't Padje et al., 2009
post-vent region curvature, abnormal	WT + MO1-fxr1	Fig. 2 from van't Padje et al., 2009
post-vent region decreased length, abnormal	WT + MO1-fxr1	Fig. 2 from van't Padje et al., 2009
skeletal muscle myoblast nucleus circular, abnormal	WT + MO1-fxr1	Fig. 3 from van't Padje et al., 2009
somite U-shaped, abnormal	WT + MO1-fxr1	Fig. 3 from van't Padje et al., 2009
striated muscle cell development disrupted, abnormal	WT + MO1-fxr1	Fig. 3 from van't Padje et al., 2009

Phenotype of all Fish created by or utilizing MO1-fxr1

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	WT + MO1-fxr1	standard conditions	Fig. 2, Fig. 3 from van't Padje et al., 2009
heart linear, abnormal	WT + MO1-fxr1	standard conditions	Fig. 5 from van't Padje et al., 2009
post-vent region decreased length, abnormal	WT + MO1-fxr1	standard conditions	Fig. 2 from van't Padje et al., 2009
somite U-shaped, abnormal	WT + MO1-fxr1	standard conditions	Fig. 3 from van't Padje et al., 2009
heart looping disrupted, abnormal	WT + MO1-fxr1	standard conditions	Fig. 5 from van't Padje et al., 2009
atrium tubular, abnormal	WT + MO1-fxr1	standard conditions	Fig. 5 from van't Padje et al., 2009
heart decreased functionality, abnormal	WT + MO1-fxr1	standard conditions	Fig. 5 from van't Padje et al., 2009
striated muscle cell development disrupted, abnormal	WT + MO1-fxr1	standard conditions	Fig. 3 from van't Padje et al., 2009
myotome myofibril irregular spatial pattern, abnormal	WT + MO1-fxr1	standard conditions	Fig. 3 from van't Padje et al., 2009
post-vent region curvature, abnormal	WT + MO1-fxr1	standard conditions	Fig. 2 from van't Padje et al., 2009
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-fxr1	standard conditions	Fig. 2, Fig. 3 from van't Padje et al., 2009
cardiac ventricle tubular, abnormal	WT + MO1-fxr1	standard conditions	Fig. 5 from van't Padje et al., 2009
horizontal myoseptum aplastic, abnormal	WT + MO1-fxr1	standard conditions	Fig. 3 from van't Padje et al., 2009
heart contraction decreased rate, abnormal	WT + MO1-fxr1	standard conditions	text only from van't Padje et al., 2009
skeletal muscle myoblast nucleus circular, abnormal	WT + MO1-fxr1	standard conditions	Fig. 3 from van't Padje et al., 2009

Citations