Morpholino

MO2-tyrp1b

ID

ZDB-MRPHLNO-091218-5

Name

MO2-tyrp1b

Previous Names

MO Dre_tyrp1b_ATG (1)

Target

tyrp1b (1)

Sequence

5' - GCACTAAACACACACTCTTCCACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tyrp1b

No data available

Phenotype

Phenotype resulting from MO2-tyrp1b

No data available

Phenotype of all Fish created by or utilizing MO2-tyrp1b

Phenotype	Fish	Conditions	Figures
retinal pigmented epithelium zinc atom decreased amount, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
retinal pigmented epithelium melanocyte absent, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
lens reflectivity, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 3 from Takamiya et al., 2016
retinal pigmented epithelium selenium atom decreased amount, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
retinal pigmented epithelium strontium atom decreased amount, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
retinal pigmented epithelium potassium atom decreased amount, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
melanoblast cell maturation arrested, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
lens structure, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 3 from Takamiya et al., 2016
retinal pigmented epithelium bromine atom decreased amount, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
retinal pigmented epithelium calcium atom decreased amount, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
retinal pigmented epithelium manganese atom decreased amount, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
retinal pigmented epithelium barium atom decreased amount, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
retinal pigmented epithelium melanins brown, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
retinal pigmented epithelium intracellular chemical homeostasis disrupted, abnormal	WT + MO1-tyrp1a + MO2-tyrp1b	standard conditions	Fig. 2 from Takamiya et al., 2016
retinal pigmented epithelium brown, abnormal	WT + MO2-tyrp1a + MO2-tyrp1b	standard conditions	Fig. S3 from Braasch et al., 2009
melanocyte brown, abnormal	WT + MO2-tyrp1a + MO2-tyrp1b	standard conditions	Fig. S3 from Braasch et al., 2009

Citations