Morpholino
MO1-plpp1b
- ID
- ZDB-MRPHLNO-091218-2
- Name
- MO1-plpp1b
- Previous Names
-
- MO1-ppap2ab
- SZ185 (1)
- Target
- Sequence
-
5' - GCTTCTGCTCATCAAACTGCTGAAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-plpp1b
No data available
Phenotype
Phenotype resulting from MO1-plpp1b
No data available
Phenotype of all Fish created by or utilizing MO1-plpp1b
1 - 4 of 4
Citations
- Paksa, A., Bandemer, J., Hoeckendorf, B., Razin, N., Tarbashevich, K., Minina, S., Meyen, D., Biundo, A., Leidel, S.A., Peyrieras, N., Gov, N.S., Keller, P.J., Raz, E. (2016) Repulsive cues combined with physical barriers and cell-cell adhesion determine progenitor cell positioning during organogenesis. Nature communications. 7:11288
- Kalén, M., Wallgard, E., Asker, N., Nasevicius, A., Athley, E., Billgren, E., Larson, J.D., Wadman, S.A., Norseng, E., Clark, K.J., He, L., Karlsson-Lindahl, L., Häger, A.K., Weber, H., Augustin, H., Samuelsson, T., Kemmet, C.K., Utesch, C.M., Essner, J.J., Hackett, P.B., and Hellström, M. (2009) Combination of reverse and chemical genetic screens reveals angiogenesis inhibitors and targets. Chemistry & Biology. 16(4):432-441
1 - 2 of 2
Show