Morpholino
MO3-dicer1
- ID
- ZDB-MRPHLNO-091023-1
- Name
- MO3-dicer1
- Previous Names
- None
- Target
- Sequence
-
5' - TCTTTCTCTTCATCTTCCTCCGATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dicer1
No data available
Phenotype
Phenotype resulting from MO3-dicer1
No data available
Phenotype of all Fish created by or utilizing MO3-dicer1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| fin regeneration paedomorphic growth, abnormal | WT + MO3-dicer1 | amputation: caudal fin |
Fig. 1
from Thatcher et al., 2008 |
| regenerating fin hypoplastic, abnormal | WT + MO3-dicer1 | amputation: caudal fin |
Fig. 1
from Thatcher et al., 2008 |
1 - 2 of 2
Citations
- Piatek, M.J., Henderson, V., Fearn, A., Chaudhry, B., Werner, A. (2017) Ectopically expressed Slc34a2a sense-antisense transcripts cause a cerebellar phenotype in zebrafish embryos depending on RNA complementarity and Dicer. PLoS One. 12:e0178219
- Andrews, O.E., Cha, D.J., Wei, C., Patton, J.G. (2014) RNAi-Mediated Gene silencing in Zebrafish Triggered by Convergent Transcription. Scientific Reports. 4:5222
- Thatcher, E.J., Paydar, I., Anderson, K.K., and Patton, J.G. (2008) Regulation of zebrafish fin regeneration by microRNAs. Proceedings of the National Academy of Sciences of the United States of America. 105(47):18384-18389
1 - 3 of 3
Show