Morpholino

MO1-hlx1

ID
ZDB-MRPHLNO-091020-3
Name
MO1-hlx1
Previous Names
None
Target
Sequence
5' - AGCCGAACAATACGCAGTCCACAGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 20
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hlx1
Expressed Gene Anatomy Figures
pparaa Fig. 2 from Piragyte et al., 2018
pparab Fig. 2 from Piragyte et al., 2018
pparda Fig. 2 from Piragyte et al., 2018
ppardb Fig. 2 from Piragyte et al., 2018
pparg Fig. 2 from Piragyte et al., 2018
rag1 Fig. 1 with image from Piragyte et al., 2018
runx1 Fig. 1 with image from Piragyte et al., 2018
Phenotype
Phenotype resulting from MO1-hlx1
Phenotype Fish Figures
blood circulation absent, abnormal WT + MO1-hlx1 text only from Ebarasi et al., 2009
endothelial cell pparab expression decreased amount, abnormal s843Tg + MO1-hlx1 Fig. 2 from Piragyte et al., 2018
endothelial cell pparda expression decreased amount, abnormal s843Tg + MO1-hlx1 Fig. 2 from Piragyte et al., 2018
endothelial cell pparaa expression decreased amount, abnormal s843Tg + MO1-hlx1 Fig. 2 from Piragyte et al., 2018
endothelial cell ppardb expression decreased amount, abnormal s843Tg + MO1-hlx1 Fig. 2 from Piragyte et al., 2018
endothelial cell pparg expression decreased amount, abnormal s843Tg + MO1-hlx1 Fig. 2 from Piragyte et al., 2018
endothelial cell cell population proliferation decreased occurrence, abnormal TU + MO1-hlx1 Fig. 1 with image from Piragyte et al., 2018
endothelial cell mitochondrial ATP synthesis coupled electron transport increased process quality, abnormal s843Tg + MO1-hlx1 Fig. 3 from Piragyte et al., 2018
endothelial cell mitochondrion decreased amount, abnormal s843Tg + MO1-hlx1 Fig. 3 from Piragyte et al., 2018
hematopoietic stem cell decreased amount, abnormal cz2010Tg + MO1-hlx1 Fig. 1 with image,  Fig. 3 from Piragyte et al., 2018
pericardium edematous, abnormal WT + MO1-hlx1 text only from Ebarasi et al., 2009
thymus rag1 expression decreased amount, abnormal TU + MO1-hlx1 Fig. 1 with image from Piragyte et al., 2018
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal TU + MO1-hlx1 Fig. 1 with image from Piragyte et al., 2018
yolk edematous, abnormal WT + MO1-hlx1 text only from Ebarasi et al., 2009
Phenotype of all Fish created by or utilizing MO1-hlx1
Phenotype Fish Conditions Figures
thymus rag1 expression decreased amount, abnormal TU + MO1-hlx1 control Fig. 1 with image from Piragyte et al., 2018
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal TU + MO1-hlx1 control Fig. 1 with image from Piragyte et al., 2018
hematopoietic stem cell decreased amount, abnormal TU + MO1-hlx1 control Fig. 1 with image from Piragyte et al., 2018
endothelial cell cell population proliferation decreased occurrence, abnormal TU + MO1-hlx1 control Fig. 1 with image from Piragyte et al., 2018
pericardium edematous, abnormal WT + MO1-hlx1 standard conditions text only from Ebarasi et al., 2009
blood circulation absent, abnormal WT + MO1-hlx1 standard conditions text only from Ebarasi et al., 2009
yolk edematous, abnormal WT + MO1-hlx1 standard conditions text only from Ebarasi et al., 2009
intersegmental vein blood circulation disrupted, abnormal WT + MO1-hlx1 + MO2-hlx1 standard conditions Fig. 3 with image from Herbert et al., 2012
hematopoietic stem cell decreased amount, abnormal cz2010Tg + MO1-hlx1 control Fig. 1 with image from Piragyte et al., 2018
endothelial cell pparg expression decreased amount, abnormal s843Tg + MO1-hlx1 control Fig. 2 from Piragyte et al., 2018
endothelial cell pparda expression decreased amount, abnormal s843Tg + MO1-hlx1 control Fig. 2 from Piragyte et al., 2018
hematopoietic stem cell increased amount, abnormal s843Tg + MO1-hlx1 chemical treatment by environment: PPARbeta/delta agonist Fig. 3 from Piragyte et al., 2018
endothelial cell pparab expression decreased amount, abnormal s843Tg + MO1-hlx1 control Fig. 2 from Piragyte et al., 2018
endothelial cell pparaa expression decreased amount, abnormal s843Tg + MO1-hlx1 control Fig. 2 from Piragyte et al., 2018
endothelial cell mitochondrial ATP synthesis coupled electron transport increased process quality, abnormal s843Tg + MO1-hlx1 control Fig. 3 from Piragyte et al., 2018
endothelial cell ppardb expression decreased amount, abnormal s843Tg + MO1-hlx1 control Fig. 2 from Piragyte et al., 2018
hematopoietic stem cell decreased amount, abnormal s843Tg + MO1-hlx1 control Fig. 3 from Piragyte et al., 2018
endothelial cell mitochondrion decreased amount, abnormal s843Tg + MO1-hlx1 control Fig. 3 from Piragyte et al., 2018
intersegmental vein shortened, abnormal s843Tg + MO1-hlx1 + MO2-hlx1 standard conditions Fig. 3 with image from Herbert et al., 2012
intersegmental vein sprouting angiogenesis disrupted, abnormal s843Tg + MO1-hlx1 + MO2-hlx1 standard conditions Fig. 3 with image from Herbert et al., 2012
intersegmental vein malformed, abnormal s843Tg + MO1-hlx1 + MO2-hlx1 standard conditions Fig. 3 with image from Herbert et al., 2012
intersegmental vein arrested, abnormal s843Tg + MO1-hlx1 + MO2-hlx1 standard conditions Fig. 3 with image from Herbert et al., 2012
intersegmental vein sprouting angiogenesis delayed, abnormal s843Tg + MO1-hlx1 + MO2-hlx1 standard conditions Fig. 3 with image from Herbert et al., 2012
intersegmental vein lacks parts or has fewer parts of type endothelial cell, abnormal ubs1Tg + MO1-hlx1 + MO2-hlx1 standard conditions Fig. 3 with image from Herbert et al., 2012
intersegmental vein cell population proliferation decreased occurrence, abnormal ubs1Tg + MO1-hlx1 + MO2-hlx1 standard conditions Fig. 3 with image from Herbert et al., 2012
Citations
TSV
1 - 3 of 3
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.