Morpholino

MO1-hlx1

ID

ZDB-MRPHLNO-091020-3

Name

MO1-hlx1

Previous Names

None

Target

hlx1 (1)

Sequence

5' - AGCCGAACAATACGCAGTCCACAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hlx1

Expressed Gene	Anatomy	Figures
pparaa	endothelial cell	Fig. 2 from Piragyte et al., 2018
pparab	endothelial cell	Fig. 2 from Piragyte et al., 2018
pparda	endothelial cell	Fig. 2 from Piragyte et al., 2018
ppardb	endothelial cell	Fig. 2 from Piragyte et al., 2018
pparg	endothelial cell	Fig. 2 from Piragyte et al., 2018
rag1	thymus	Fig. 1 from Piragyte et al., 2018
runx1	hematopoietic multipotent progenitor cell ventral wall of dorsal aorta	Fig. 1 from Piragyte et al., 2018

Phenotype

Phenotype resulting from MO1-hlx1

Phenotype	Fish	Figures
blood circulation absent, abnormal	WT + MO1-hlx1	text only from Ebarasi et al., 2009
endothelial cell pparab expression decreased amount, abnormal	s843Tg + MO1-hlx1	Fig. 2 from Piragyte et al., 2018
endothelial cell pparda expression decreased amount, abnormal	s843Tg + MO1-hlx1	Fig. 2 from Piragyte et al., 2018
endothelial cell pparaa expression decreased amount, abnormal	s843Tg + MO1-hlx1	Fig. 2 from Piragyte et al., 2018
endothelial cell ppardb expression decreased amount, abnormal	s843Tg + MO1-hlx1	Fig. 2 from Piragyte et al., 2018
endothelial cell pparg expression decreased amount, abnormal	s843Tg + MO1-hlx1	Fig. 2 from Piragyte et al., 2018
endothelial cell cell population proliferation decreased occurrence, abnormal	TU + MO1-hlx1	Fig. 1 from Piragyte et al., 2018
endothelial cell mitochondrial ATP synthesis coupled electron transport increased process quality, abnormal	s843Tg + MO1-hlx1	Fig. 3 from Piragyte et al., 2018
endothelial cell mitochondrion decreased amount, abnormal	s843Tg + MO1-hlx1	Fig. 3 from Piragyte et al., 2018
hematopoietic stem cell decreased amount, abnormal	s843Tg + MO1-hlx1	Fig. 1 , Fig. 3 from Piragyte et al., 2018
pericardium edematous, abnormal	WT + MO1-hlx1	text only from Ebarasi et al., 2009
thymus rag1 expression decreased amount, abnormal	TU + MO1-hlx1	Fig. 1 from Piragyte et al., 2018
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal	TU + MO1-hlx1	Fig. 1 from Piragyte et al., 2018
yolk edematous, abnormal	WT + MO1-hlx1	text only from Ebarasi et al., 2009

Phenotype of all Fish created by or utilizing MO1-hlx1

Phenotype	Fish	Conditions	Figures
thymus rag1 expression decreased amount, abnormal	TU + MO1-hlx1	control	Fig. 1 from Piragyte et al., 2018
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal	TU + MO1-hlx1	control	Fig. 1 from Piragyte et al., 2018
hematopoietic stem cell decreased amount, abnormal	TU + MO1-hlx1	control	Fig. 1 from Piragyte et al., 2018
endothelial cell cell population proliferation decreased occurrence, abnormal	TU + MO1-hlx1	control	Fig. 1 from Piragyte et al., 2018
pericardium edematous, abnormal	WT + MO1-hlx1	standard conditions	text only from Ebarasi et al., 2009
blood circulation absent, abnormal	WT + MO1-hlx1	standard conditions	text only from Ebarasi et al., 2009
yolk edematous, abnormal	WT + MO1-hlx1	standard conditions	text only from Ebarasi et al., 2009
intersegmental vein blood circulation disrupted, abnormal	WT + MO1-hlx1 + MO2-hlx1	standard conditions	Fig. 3 from Herbert et al., 2012
hematopoietic stem cell decreased amount, abnormal	cz2010Tg + MO1-hlx1	control	Fig. 1 from Piragyte et al., 2018
endothelial cell pparg expression decreased amount, abnormal	s843Tg + MO1-hlx1	control	Fig. 2 from Piragyte et al., 2018
endothelial cell pparda expression decreased amount, abnormal	s843Tg + MO1-hlx1	control	Fig. 2 from Piragyte et al., 2018
hematopoietic stem cell increased amount, abnormal	s843Tg + MO1-hlx1	chemical treatment by environment: PPARbeta/delta agonist	Fig. 3 from Piragyte et al., 2018
endothelial cell pparab expression decreased amount, abnormal	s843Tg + MO1-hlx1	control	Fig. 2 from Piragyte et al., 2018
endothelial cell pparaa expression decreased amount, abnormal	s843Tg + MO1-hlx1	control	Fig. 2 from Piragyte et al., 2018
endothelial cell mitochondrial ATP synthesis coupled electron transport increased process quality, abnormal	s843Tg + MO1-hlx1	control	Fig. 3 from Piragyte et al., 2018
endothelial cell ppardb expression decreased amount, abnormal	s843Tg + MO1-hlx1	control	Fig. 2 from Piragyte et al., 2018
hematopoietic stem cell decreased amount, abnormal	s843Tg + MO1-hlx1	control	Fig. 3 from Piragyte et al., 2018
endothelial cell mitochondrion decreased amount, abnormal	s843Tg + MO1-hlx1	control	Fig. 3 from Piragyte et al., 2018
intersegmental vein shortened, abnormal	s843Tg + MO1-hlx1 + MO2-hlx1	standard conditions	Fig. 3 from Herbert et al., 2012
intersegmental vein sprouting angiogenesis disrupted, abnormal	s843Tg + MO1-hlx1 + MO2-hlx1	standard conditions	Fig. 3 from Herbert et al., 2012
intersegmental vein malformed, abnormal	s843Tg + MO1-hlx1 + MO2-hlx1	standard conditions	Fig. 3 from Herbert et al., 2012
intersegmental vein arrested, abnormal	s843Tg + MO1-hlx1 + MO2-hlx1	standard conditions	Fig. 3 from Herbert et al., 2012
intersegmental vein sprouting angiogenesis delayed, abnormal	s843Tg + MO1-hlx1 + MO2-hlx1	standard conditions	Fig. 3 from Herbert et al., 2012
intersegmental vein lacks parts or has fewer parts of type endothelial cell, abnormal	ubs1Tg + MO1-hlx1 + MO2-hlx1	standard conditions	Fig. 3 from Herbert et al., 2012
intersegmental vein cell population proliferation decreased occurrence, abnormal	ubs1Tg + MO1-hlx1 + MO2-hlx1	standard conditions	Fig. 3 from Herbert et al., 2012

Citations