Morpholino

MO2-igf2b

ID

ZDB-MRPHLNO-090929-4

Name

MO2-igf2b

Previous Names

2bMO2 (1)

Target

igf2b (1)

Sequence

5' - TAGTGAAGGTCGGATTAAGTCCCCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-igf2b

No data available

Phenotype

Phenotype resulting from MO2-igf2b

Phenotype	Fish	Figures
convergent extension involved in axis elongation delayed, abnormal	AB/TU + MO2-igf2b	text only from White et al., 2009
notochord undulate, abnormal	AB/TU + MO2-igf2b	text only from White et al., 2009
whole organism curved ventral, abnormal	AB/TU + MO2-igf2b	text only from White et al., 2009

Phenotype of all Fish created by or utilizing MO2-igf2b

Phenotype	Fish	Conditions	Figures
renal system process disrupted, abnormal	AB/TU + MO1-igf2b + MO2-igf2b	standard conditions	Fig. 6 from White et al., 2009
whole organism curved ventral, abnormal	AB/TU + MO1-igf2b + MO2-igf2b	standard conditions	text only from White et al., 2009
pronephric duct medial side fused with pronephric duct medial side, abnormal	AB/TU + MO1-igf2b + MO2-igf2b	standard conditions	Fig. 6 from White et al., 2009
notochord undulate, abnormal	AB/TU + MO1-igf2b + MO2-igf2b	standard conditions	Fig. 4, text only from White et al., 2009
trunk has fewer parts of type somite, abnormal	AB/TU + MO1-igf2b + MO2-igf2b	standard conditions	Fig. 4 from White et al., 2009
whole organism edematous, abnormal	AB/TU + MO1-igf2b + MO2-igf2b	standard conditions	Fig. 6 from White et al., 2009
forebrain morphology, abnormal	AB/TU + MO1-igf2b + MO2-igf2b	standard conditions	Fig. 5 from White et al., 2009
convergent extension involved in axis elongation delayed, abnormal	AB/TU + MO1-igf2b + MO2-igf2b	standard conditions	text only from White et al., 2009
notochord development delayed, abnormal	AB/TU + MO1-igf2b + MO2-igf2b	standard conditions	Fig. 4 from White et al., 2009
somite specification disrupted, abnormal	AB/TU + MO1-igf2b + MO2-igf2b	standard conditions	Fig. 4 from White et al., 2009
notochord undulate, abnormal	AB/TU + MO2-igf2b	standard conditions	text only from White et al., 2009
whole organism curved ventral, abnormal	AB/TU + MO2-igf2b	standard conditions	text only from White et al., 2009
convergent extension involved in axis elongation delayed, abnormal	AB/TU + MO2-igf2b	standard conditions	text only from White et al., 2009
intersegmental vessel sprouting angiogenesis disrupted, abnormal	y7Tg + MO2-igf2b + MO3-igf2b + MO4-tp53	standard conditions	Fig. 4 from Dallinga et al., 2018
intersegmental vessel filopodium decreased amount, abnormal	y7Tg + MO2-igf2b + MO3-igf2b + MO4-tp53	standard conditions	Fig. 4 from Dallinga et al., 2018
trunk has fewer parts of type somite, abnormal	AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53	standard conditions	Fig. 4 from White et al., 2009
whole organism curved ventral, abnormal	AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53	standard conditions	text only from White et al., 2009
somite specification disrupted, abnormal	AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53	standard conditions	Fig. 4 from White et al., 2009
notochord undulate, abnormal	AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53	standard conditions	text only from White et al., 2009

Citations