ZFIN ID: ZDB-MRPHLNO-090923-3
Morpholino Name: MO3-psen2
Target: psen2 (1)
Previous Name: Mopsen2Ac8 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATCTGAAAAACACACGACACTCACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-psen2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-psen2
Expressed Gene Anatomy Figures
ccng1 Fig. 2text only from Newman et al., 2009
ctslb Fig. 2text only from Newman et al., 2009
gnmt text only from Newman et al., 2009
he1.1 text only from Newman et al., 2009
hsp70.1 text only from Newman et al., 2009
nt5c3a text only from Newman et al., 2009
pkp3a text only from Newman et al., 2009
psap text only from Newman et al., 2009
PHENOTYPE
Phenotype resulting from MO3-psen2
No data available

Phenotype of all Fish created by or utilizing MO3-psen2
No data available
Genome Resources:
CITATIONS (1)