Morpholino

MO2-ints11

ID
ZDB-MRPHLNO-090910-1
Name
MO2-ints11
Previous Names
  • Ints11 SMO (1)
  • MO2-cpsf3l
Target
Sequence
5' - AGATGGAAATGACTGAGAGGAAGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ints11
No data available
Phenotype
Phenotype resulting from MO2-ints11
Phenotype Fish Figures
cranial nerve V isl1a expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
cranial nerve VII isl1a expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
cranial nerve X isl1a expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
epiphysis isl1a expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
forebrain isl1a expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
head decreased length, abnormal AB + MO2-ints11 FIGURE 2 with image from Pistocchi et al., 2026
hemopoiesis disrupted, abnormal WT + MO2-ints11 Fig. 6 with image from Tao et al., 2009
hindbrain isl1a expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
midbrain hindbrain boundary pax2a expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
mRNA splicing, via spliceosome disrupted, abnormal WT + MO2-ints11 Fig. 7 with image from Tao et al., 2009
optic tectum isl1a expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
post-vent region decreased length, abnormal AB + MO2-ints11 FIGURE 2 with image,  FIGURE 4 with image from Pistocchi et al., 2026
retinal ganglion cell isl1a expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
retinal inner nuclear layer isl1a expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
rhombomere 3 egr2b expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
rhombomere 5 egr2b expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
spinal cord egr2b expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
spinal cord isl1a expression decreased distribution, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
thigmotaxis decreased process quality, abnormal AB + MO2-ints11 FIGURE 1 with image,  FIGURE 2 with image from Pistocchi et al., 2026
whole organism gfap expression decreased amount, abnormal AB + MO2-ints11 FIGURE 3 with image,  FIGURE 4 with image from Pistocchi et al., 2026
whole organism runx1 expression decreased amount, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
whole organism map2 expression decreased amount, abnormal AB + MO2-ints11 FIGURE 3 with image,  FIGURE 4 with image from Pistocchi et al., 2026
whole organism mag expression decreased amount, abnormal AB + MO2-ints11 FIGURE 3 with image,  FIGURE 4 with image from Pistocchi et al., 2026
whole organism sox10 expression decreased amount, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
whole organism decreased length, abnormal AB + MO2-ints11 FIGURE 2 with image,  FIGURE 4 with image from Pistocchi et al., 2026
whole organism decreased size, abnormal AB + MO2-ints11 FIGURE 1 with image from Pistocchi et al., 2026
whole organism nes expression increased amount, abnormal AB + MO2-ints11 FIGURE 3 with image from Pistocchi et al., 2026
Phenotype of all Fish created by or utilizing MO2-ints11
Phenotype Fish Conditions Figures
whole organism mag expression decreased amount, abnormal AB + MO2-ints11 control FIGURE 3 with image,  FIGURE 4 with image from Pistocchi et al., 2026
whole organism map2 expression decreased amount, abnormal AB + MO2-ints11 control FIGURE 3 with image,  FIGURE 4 with image from Pistocchi et al., 2026
rhombomere 3 egr2b expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
whole organism sox10 expression decreased amount, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
epiphysis isl1a expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
spinal cord egr2b expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
rhombomere 5 egr2b expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
whole organism nes expression increased amount, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
thigmotaxis decreased process quality, abnormal AB + MO2-ints11 control FIGURE 1 with image,  FIGURE 2 with image from Pistocchi et al., 2026
whole organism gfap expression decreased amount, abnormal AB + MO2-ints11 control FIGURE 3 with image,  FIGURE 4 with image from Pistocchi et al., 2026
retinal ganglion cell isl1a expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
whole organism runx1 expression decreased amount, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
midbrain hindbrain boundary pax2a expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
swimming behavior decreased process quality, abnormal AB + MO2-ints11 lighting conditions FIGURE 2 with image,  FIGURE 4 with image from Pistocchi et al., 2026
forebrain isl1a expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
retinal inner nuclear layer isl1a expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
whole organism decreased size, abnormal AB + MO2-ints11 control FIGURE 1 with image from Pistocchi et al., 2026
optic tectum isl1a expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
whole organism decreased length, abnormal AB + MO2-ints11 control FIGURE 2 with image,  FIGURE 4 with image from Pistocchi et al., 2026
spinal cord isl1a expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
cranial nerve VII isl1a expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
hindbrain isl1a expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
head decreased length, abnormal AB + MO2-ints11 control FIGURE 2 with image from Pistocchi et al., 2026
cranial nerve X isl1a expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
cranial nerve V isl1a expression decreased distribution, abnormal AB + MO2-ints11 control FIGURE 3 with image from Pistocchi et al., 2026
post-vent region decreased length, abnormal AB + MO2-ints11 control FIGURE 2 with image,  FIGURE 4 with image from Pistocchi et al., 2026
mRNA splicing, via spliceosome disrupted, abnormal WT + MO2-ints11 standard conditions Fig. 7 with image from Tao et al., 2009
hemopoiesis disrupted, abnormal WT + MO2-ints11 standard conditions Fig. 6 with image from Tao et al., 2009
Citations