Morpholino

MO1-kif3b

ID
ZDB-MRPHLNO-090909-1
Name
MO1-kif3b
Previous Names
  • aKIF3B (1)
Target
Sequence
5' - GTTGGCCTGCTGGATTCTCCGAATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocking morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kif3b
Expressed Gene Anatomy Figures
kif3a Fig. 2 with image from Insinna et al., 2009
kif3b Fig. 2 with image from Insinna et al., 2009
kif17 Fig. 2 with image from Insinna et al., 2009
Phenotype
Phenotype resulting from MO1-kif3b
Phenotype Fish Figures
brain hydrocephalic, abnormal AB/TU + MO1-kif3b Fig. 2 with image from Insinna et al., 2009
eye decreased size, abnormal AB/TU + MO1-kif3b Fig. 2 with image from Insinna et al., 2009
optic stalk morphology, abnormal AB/TU + MO1-kif3b Fig. 2 with image from Insinna et al., 2009
pericardium edematous, abnormal AB/TU + MO1-kif3b Fig. 2 with image from Insinna et al., 2009
photoreceptor cell differentiation disrupted, abnormal AB/TU + MO1-kif3b Fig. 2 with image from Insinna et al., 2009
photoreceptor outer segment layer aplastic, abnormal AB/TU + MO1-kif3b Fig. 2 with image from Insinna et al., 2009
retina development in camera-type eye delayed, abnormal AB/TU + MO1-kif3b Fig. 2 with image from Insinna et al., 2009
retina layer formation disrupted, abnormal AB/TU + MO1-kif3b Fig. 2 with image from Insinna et al., 2009
retinal neural layer morphology, abnormal AB/TU + MO1-kif3b Fig. 2 with image from Insinna et al., 2009
whole organism curved, abnormal AB/TU + MO1-kif3b Fig. 2 with image from Insinna et al., 2009
whole organism lethal (sensu genetics), abnormal AB/TU + MO1-kif3b Fig. 2 with image from Insinna et al., 2009
Phenotype of all Fish created by or utilizing MO1-kif3b
Phenotype Fish Conditions Figures
whole organism lethal (sensu genetics), abnormal AB/TU + MO1-kif3b standard conditions Fig. 2 with image from Insinna et al., 2009
retinal neural layer morphology, abnormal AB/TU + MO1-kif3b standard conditions Fig. 2 with image from Insinna et al., 2009
retina layer formation disrupted, abnormal AB/TU + MO1-kif3b standard conditions Fig. 2 with image from Insinna et al., 2009
retina development in camera-type eye delayed, abnormal AB/TU + MO1-kif3b standard conditions Fig. 2 with image from Insinna et al., 2009
photoreceptor outer segment layer aplastic, abnormal AB/TU + MO1-kif3b standard conditions Fig. 2 with image from Insinna et al., 2009
photoreceptor cell differentiation disrupted, abnormal AB/TU + MO1-kif3b standard conditions Fig. 2 with image from Insinna et al., 2009
eye decreased size, abnormal AB/TU + MO1-kif3b standard conditions Fig. 2 with image from Insinna et al., 2009
pericardium edematous, abnormal AB/TU + MO1-kif3b standard conditions Fig. 2 with image from Insinna et al., 2009
whole organism curved, abnormal AB/TU + MO1-kif3b standard conditions Fig. 2 with image from Insinna et al., 2009
optic stalk morphology, abnormal AB/TU + MO1-kif3b standard conditions Fig. 2 with image from Insinna et al., 2009
brain hydrocephalic, abnormal AB/TU + MO1-kif3b standard conditions Fig. 2 with image from Insinna et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.