ZFIN ID: ZDB-MRPHLNO-090828-5
Morpholino Name: MO1-ncaph
Target: ncaph (1)
Sequence:
5' - ACTAAATGCGCTCATAACGAAACTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ncaph No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ncaph No data available
PHENOTYPE
Phenotype resulting from MO1-ncaph
Phenotype Figures
eye decreased size, abnormal Fig. 5 with image from Seipold et al., 2009
head decreased size, abnormal Fig. 5 with image from Seipold et al., 2009
retina decreased size, abnormal Fig. 5 with image from Seipold et al., 2009
retina nucleus increased size, abnormal Fig. 5 with image from Seipold et al., 2009
retina nucleus variability of shape, abnormal Fig. 5 with image from Seipold et al., 2009
whole organism ploidy, abnormal text only from Seipold et al., 2009

Phenotype of all Fish created by or utilizing MO1-ncaph
Phenotype Fish Conditions Figures
whole organism ploidy, abnormal WT + MO1-ncaph standard conditions text only from Seipold et al., 2009
head decreased size, abnormal WT + MO1-ncaph standard conditions Fig. 5 with image from Seipold et al., 2009
retina nucleus variability of shape, abnormal WT + MO1-ncaph standard conditions Fig. 5 with image from Seipold et al., 2009
eye decreased size, abnormal WT + MO1-ncaph standard conditions Fig. 5 with image from Seipold et al., 2009
retina nucleus increased size, abnormal WT + MO1-ncaph standard conditions Fig. 5 with image from Seipold et al., 2009
retina decreased size, abnormal WT + MO1-ncaph standard conditions Fig. 5 with image from Seipold et al., 2009
whole organism ploidy, abnormal WT + MO1-ncaph + MO4-tp53 standard conditions text only from Seipold et al., 2009
OTHER MO1-ncaph MORPHOLINO PAGESNo links to external sites
CITATIONS (1)