Morpholino

MO1-eaf2

ID
ZDB-MRPHLNO-090820-6
Name
MO1-eaf2
Previous Names
  • Eaf2-MO1 (1)
Target
Sequence
5' - ATATGCTGTTCCATTCATTCTAATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-eaf2
No data available
Phenotype
Phenotype resulting from MO1-eaf2
Phenotype Fish Figures
adaxial cell position, abnormal AB + MO1-eaf2 Fig. 3 from Liu et al., 2009
axial chorda mesoderm decreased length, abnormal AB + MO1-eaf2 Fig. 3 from Liu et al., 2009
convergent extension involved in axis elongation disrupted, abnormal AB + MO1-eaf2 Fig. 2Fig. 3 from Liu et al., 2009
convergent extension involved in organogenesis disrupted, abnormal AB + MO1-eaf2 Fig. 6 from Liu et al., 2009
head decreased size, abnormal AB + MO1-eaf2 Fig. 2 from Liu et al., 2009
heart development disrupted, abnormal AB + MO1-eaf2 Fig. 6 from Liu et al., 2009
muscle cell migration disrupted, abnormal AB + MO1-eaf2 Fig. 6 from Liu et al., 2009
neural plate increased width, abnormal AB + MO1-eaf2 Fig. 3 from Liu et al., 2009
neuroectoderm anterior region decreased size, abnormal WT + MO1-eaf2 Fig. 1 with imageFig. 2 with image from Liu et al., 2013
post-vent region decreased length, abnormal AB + MO1-eaf2 Fig. 2 from Liu et al., 2009
presumptive ectoderm gata2a expression decreased amount, abnormal AB + MO1-eaf2 Fig. S1 from Liu et al., 2017
presumptive ectoderm foxi1 expression decreased amount, abnormal AB + MO1-eaf2 Fig. S1 from Liu et al., 2017
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB + MO1-eaf2 Fig. S1 from Liu et al., 2017
presumptive endoderm foxa3 expression increased amount, abnormal AB + MO1-eaf2 Fig. S1 from Liu et al., 2017
presumptive endoderm gata5 expression increased amount, abnormal AB + MO1-eaf2 Fig. S1 from Liu et al., 2017
transforming growth factor beta receptor signaling pathway decreased process quality, abnormal AB + MO1-eaf2 Fig. 7 from Liu et al., 2017
whole organism decreased length, abnormal AB + MO1-eaf2 Fig. 2 from Liu et al., 2009
Phenotype of all Fish created by or utilizing MO1-eaf2
Phenotype Fish Conditions Figures
convergent extension involved in organogenesis disrupted, abnormal AB + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2009
presumptive endoderm gata5 expression increased amount, abnormal AB + MO1-eaf2 standard conditions Fig. S1 from Liu et al., 2017
whole organism decreased length, abnormal AB + MO1-eaf2 standard conditions Fig. 2 from Liu et al., 2009
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB + MO1-eaf2 standard conditions Fig. S1 from Liu et al., 2017
post-vent region decreased length, abnormal AB + MO1-eaf2 standard conditions Fig. 2 from Liu et al., 2009
neural plate increased width, abnormal AB + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
transforming growth factor beta receptor signaling pathway decreased process quality, abnormal AB + MO1-eaf2 standard conditions Fig. 7 from Liu et al., 2017
axial chorda mesoderm decreased length, abnormal AB + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
adaxial cell position, abnormal AB + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
muscle cell migration disrupted, abnormal AB + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2009
presumptive ectoderm foxi1 expression decreased amount, abnormal AB + MO1-eaf2 standard conditions Fig. S1 from Liu et al., 2017
convergent extension involved in axis elongation disrupted, abnormal AB + MO1-eaf2 standard conditions Fig. 2Fig. 3 from Liu et al., 2009
presumptive ectoderm gata2a expression decreased amount, abnormal AB + MO1-eaf2 standard conditions Fig. S1 from Liu et al., 2017
presumptive endoderm foxa3 expression increased amount, abnormal AB + MO1-eaf2 standard conditions Fig. S1 from Liu et al., 2017
heart development disrupted, abnormal AB + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2009
head decreased size, abnormal AB + MO1-eaf2 standard conditions Fig. 2 from Liu et al., 2009
neuroectoderm anterior region decreased size, abnormal WT + MO1-eaf2 standard conditions Fig. 1 with imageFig. 2 with image from Liu et al., 2013
convergent extension involved in axis elongation disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2Fig. 3Fig. 4Fig. 9 from Liu et al., 2009
presumptive endoderm gata5 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 1Fig. 6 from Liu et al., 2017
neural plate increased width, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
whole organism decreased length, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2Fig. 9 from Liu et al., 2009
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 4 from Liu et al., 2009
endoderm sox32 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2 from Liu et al., 2017
presumptive mesoderm tbxta expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 1Fig. 6 from Liu et al., 2017
adaxial cell position, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
prechordal plate mislocalised posteriorly, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
pancreas development disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2009
presumptive endoderm mixl1 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 1 from Liu et al., 2017
whole organism morphology, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2017
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 1 from Liu et al., 2017
muscle cell migration disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2009
eye fused with eye, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2Fig. 9 from Liu et al., 2009
heart development disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6Fig. 9 from Liu et al., 2009
mesoderm lft1 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2 from Liu et al., 2017
whole organism tp53 expression decreased amount, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2017
post-vent region decreased length, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2 from Liu et al., 2009
presumptive mesoderm lft1 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2 from Liu et al., 2017
presumptive mesoderm increased width, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 5 from Liu et al., 2009
convergent extension involved in organogenesis disrupted, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6Fig. 9 from Liu et al., 2009
head decreased size, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 2Fig. 9 from Liu et al., 2009
presumptive endoderm sox32 expression increased distribution, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 1 from Liu et al., 2017
presumptive endoderm increased size, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 5 from Liu et al., 2009
segmental plate decreased length, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
axial chorda mesoderm decreased length, abnormal AB + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2009
presumptive mesoderm tbxta expression amount, ameliorated AB + MO1-eaf1 + MO1-eaf2 + MO4-tp53 standard conditions Fig. 6 from Liu et al., 2017
presumptive endoderm gata5 expression amount, ameliorated tdgf1tz257/tz257 + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2017
presumptive endoderm sox32 expression amount, ameliorated tdgf1tz257/tz257 + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 3 from Liu et al., 2017
presumptive endoderm gata5 expression amount, ameliorated tp53zdf1/zdf1 + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2017
whole organism morphology, ameliorated tp53zdf1/zdf1 + MO1-eaf1 + MO1-eaf2 standard conditions Fig. 6 from Liu et al., 2017
neuroectoderm anterior region increased size, abnormal w32Tg + MO1-eaf2 heat shock Fig. 2 with image from Liu et al., 2013
Citations